GenePrediction:GLEAN_2454 Details

Name: GLEAN_2454
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1215094..1216596 (+ strand)
Length: 1503
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1215094..1215255 (+ strand)
Length: 162
Type: CDS
Source: GLEAN
Position: GCSC_140:1215309..1215439 (+ strand)
Length: 131
Type: CDS
Source: GLEAN
Position: GCSC_140:1215499..1215540 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_140:1215594..1215660 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_140:1215716..1215756 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_140:1215818..1215907 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_140:1215958..1216306 (+ strand)
Length: 349
Type: CDS
Source: GLEAN
Position: GCSC_140:1216360..1216596 (+ strand)
Length: 237
>GLEAN_2454 class=GenePrediction position=GCSC_140:1215094..1216596 (+ strand)
ATGGCAAAAACTACCAATCCTGAAATCCCGTCTCCGGCTCCAGTTCCAGCTGCAAGCCCTACACCCAATGCTCCAACAAC
ACTAGCTGCCCCGATATCACCGACTGAGGAAGAAATTACGCTTCAGCCAGGTCGCCACTGGATTGACCGTCCCTTGAATG
AAGTAGGAGAAGCCTCCAGCTCCCAGTAACAGGGCAGAACTGACTACCCTCCAAGGACGACGGTGATTCTGCGCAAGGTG
ATGATGCGGCTACCTCAACTGCATCCCTTGCATCATCTATATTACGCTACCGGACCATCAATGGCCGCACCTACCACAGT
GACTCCATCACCACAAACAAGTACTGGTAGGTTGAATGCCGCCGATTTGATGCACCTATACAGATCATAAAATAACAGTA
TCAAGGGGTGCAAATGATGCGAATCAGAACAACTCGCTAGACATTATGTAGGCTTATGCCAGCATATCTGTCTTTTCGAT
TCTATCCTAATAACATTTAGGCACCATGGCTTCTTGGTGACATTGGACGGGAAGCTAAACCTTGCGCCCTTGTCGGGACC
TATTGGAGTAAGTCGGTAGTCTGTAATAGATACTGTACCCAATATGCTGATACGAAATATAGAAAATAGTAGATCTTGGA
ACCGGAACTGGATCTTGGGCAATGTGAGATGCCTTTCCGGTCGTTATAAATGCACATCCGATTGTTTGCTAACGAATAAA
CTAGTGACTTTGCAGACTTGCACCCCGAGTGCACAGTGATTGGCACTGATGTGTCTCCTATTCAGCCGGCATGGGTGCCA
CCTAACGTGTATTTGTAAGTACGTTGATTATTTTTTGGGGTCTTCACCACTAATGTAAGCCTAGCGAGATCGACGACTTT
ACCCAGCCGTGGACTTTCGATTCAGAATCGATTGACTACGTCCATGAACGCTGGCTTGTTGGCTGCGTACCGGATTGGGT
AGCATTTTACAAAGAGGCCTATCGCGTCCTAAAGCCGGGAGGCTGGATTGAATCCTTTGCGTGCGACGGCCTGCTCGAGT
CTGACGATAACACTATGACCAAGGACTGTGCTACTAGCCAATGGAGTTATATATTCGCTGAGGGAAGTAGGAAGCTGGGC
TCTACCGCCTCGTACACTATAGTTCGTGACGAGCTACAGCGGAAATATCTTAAAGAAGCAGGCTTTGTAAACATTGAAGA
GCGCCTGATAAAGGTTTGTAACAACTTCCTTTCTAAGCTTTACCACACTCAGCTAACAACTAGCAGATGCCCATTTGCGA
ATGGTCAGATGACCCGAAATGGAAAGAAGTCGGTCTTTTTATACGCGCCGCCTTGGAGACTGACGTAGAGGGTATGGTTT
CCTACTTGGCATCTGTGCTTGGCTGGACCCAAGAGGAGATTATTGTGTACTGCGCTCATGTGCGTCGCGAGGTGCGCAGT
CTGAAAATCCATGGCTACTATCGATGCAATGTGGCATGGGCCCAAAAGCCCTTCAGCGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62