GenePrediction:GLEAN_2455 Details

Name: GLEAN_2455
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1232722..1235211 (+ strand)
Length: 2490
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1232722..1232736 (+ strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_140:1232817..1233746 (+ strand)
Length: 930
Type: CDS
Source: GLEAN
Position: GCSC_140:1233796..1234238 (+ strand)
Length: 443
Type: CDS
Source: GLEAN
Position: GCSC_140:1234605..1234790 (+ strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_140:1234872..1235211 (+ strand)
Length: 340
>GLEAN_2455 class=GenePrediction position=GCSC_140:1232722..1235211 (+ strand)
ATGGATATTCTTCGGGTAATGCGCTACCCCATGAGATTGCACGGCCACTGCTTGCTCACTCTGTTGCTTTTGCCTATTGC
TGACCGTCTCTGCAGTGCCTCGCCCGGTTCCTCGACCGGCCCAGCTTCCCATGGAAGCGACTCATCATGGGCTTCTCGGT
CGGTCAATATCTCTTCGAAGGCTTCCTTTCCTTCCGCCAGTACCAGTACCTCAAGGCGCCCGCAGCTCCCAAAGTGCTCC
AACACGAGGTCTCGCAGGAGGTGTTTGACAAAAGCCAGGCGTACGGCCGGGCCAAGGCTAAGTTTGGCTTCTACGACGGC
ATCTGGAACCAGATGCAAAACCTGGCTTTTTTCCAGTTTGATCTCCTGCCGAAGCTCTGGTCCTGGTCTGGCAAGCTGCT
GCTGCGCTGGGCGCCAGTGGCTTTCAGCGGCGAGATATCGCACTCCATCGTCTTTGTTCTCTCGACCATTCTGCTCAACC
AAATCCTGTCGCTGCCCAGCTCCGTCTACCACACCTTTGTGCTCGAAGCCAAGTTTGGCTTCAACAAGCAGACGCCCCAG
CTCTTCATCACAGACCTAATCAAGACACAGCTGCTCACCTTCACCATGGTGCCGCCCATTCTGGCTGCCTTCACGGCCAT
CGTTCGGCGCTCGGGCGACGGATTCTTCTACTACCTCTGGCTCTTCGGTGCCGGCCTGCAGGTGTTCATGATTACCATCT
ACCCCATCGTCATCCTGCCGCTGTTCAATAAGCTGTCGCCGCTGGAGGAGGGCCAGCTCAAGACCGATGTCGAGGACCTG
GCCAAGAAGCTGACGTTCCCCCTGCACGAGCTCTATGTCATCGACGGCAGCCGCCGCAGCGCCCACAGCAACGCCTACTT
TTTCGGCCTTCCCTGGAAGAAGCACATTGTCATCTACGACACGCTGATCGCGAAGAGCGAGACTCAGGAGGTCGTCGCCG
TGCTGGCCCACGAGCTGGGCCATTGGAGCCTCGGCCACACCACCCGACTGTTTGCAATTTCCCAGGTAAGAGGCCAAGGC
TTCTAACCAGATGTAACAAAACTAACGCTGCCAGGCTCACTTCTTCTACATCTTTGCCCTCTTTTCCGTCTTCATCAACA
ACAAGAGCCTGTACGCCGACTTTGGCTTTTTTAACGAGCGGCCCATGATCATCGGCTTCCTGCTGTTCTCGGACGCGCTG
GCACCTATGGACATGGTTATCAAGCTACTGATGAACGTCCTGAGCCGGCGCTACGAGTTCCAGGCAGACGCGTTCGCGCG
GGGTCTGGGCTATTCGGAAGACCTGGCACGCTCGCTGATCAAGCTGCAGATCCAGAACCTAAGCACCATGGATGCCGACT
GGATGTACGCCAACTACCACTTTTCGCACCCCATCCTGACAGAGCGGCTCAAGGCAATTGACTGGCATCCGACGGGGAAA
ATCGTGAGCGAGGAGGCGACCAAGGAGGCGACCAAGGAGGACGCTTCGACGGCAAAGGCAACAGGCCGCGATGAGCTGTA
AGGGAGATCGGTATATCATGAAGAGTGGCAGCCTTGATGGCTGCTTGACATATCTTACTATATCGTAATGCATGCCACAC
GTAAATAACGGTAGGAGACGCCTGTAATTTTCAGTTGCAGCTCACTGTAAAGCCCAGAGCTTAGGTGGTGTTTGTGCCAC
CGGGAATTCGACTCCCCACTTTTCACACACCAATCAGACGAGCCGAATCGACAGCTCGGAAACGTTGCGGAATGGAAAAA
AACTCTCGATCAGTCAATCGAGACGAGCGAGGAGACGGCACAGCACGCGACCGTGGCCGACCATTGTTCTTGACTCACAA
GTGCGCTTACGAAAGGGCCTTCTCCTGAGAACGTACAATATAGGGTCGGAGCCCAATTTGCCGTCATGAACGTCTCGCTT
GCGCGGCCAACCGTCTTTGGCGCGACCATGCGCTTGACAGCCTCGATGGCCAACCCCTTCCTCTCGTCCTCCTCTCCCAC
AGCCGGCATTCTCGCCCAGAGACTACCGCTGGCAGGTGCTTCCAGAAGCGCAGCGCAGAGCCAGATGCGGTAGGTCTTCT
GTCTGCCGTCTCTCGCCGTCCGGTATTATCTGCCACTACTCCTTGCTGATGCTGTCACTCTTCTTCAAAGGTCCTTTTCC
GTGCTGCCACAGTTGCGGCCTACAATGATGTCTGGCTATGCTGTCTTCCGGCTGGCATCAGCACCGTCTGCCCTCACGCC
ATTTTCCCCCTCCGCCTCTTCCTCCGTCTCGGCCACCCTCGACCTCGTCGCCCCCACCTCCATCTCCCGGCACCCAGCAC
TCGCCGGCTTTGGCAGCCAGCTCCGTTGTGGTCCGCGCGCAACAATGGAGCGGACCAGCCGGCTGATCCAGAAGCGGCGT
CATGGCTTCTTGAGCCGCATCCGCACCAAGAACGGCCGCAAGACGCTGCAGCGTCGGCGAGCCAAGGGCCGCAAGCGGCT
GTCCTACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62