GenePrediction:GLEAN_2457 Details

Name: GLEAN_2457
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1245994..1246574 (+ strand)
Length: 581
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1245994..1246018 (+ strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_140:1246098..1246154 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_140:1246243..1246281 (+ strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_140:1246343..1246370 (+ strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_140:1246430..1246493 (+ strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_140:1246545..1246574 (+ strand)
Length: 30
>GLEAN_2457 class=GenePrediction position=GCSC_140:1245994..1246574 (+ strand)
ATGGCCTCACAACTCCTTCCCCTCGGTATGTGAGATCGCAAGGAGAACAACGGGAGACAAATATCGGGGAAAGGACCGTG
CACTTGCTGACGTTTTATTCTCAGAGCTTATCGACAAATGTGTCGGGTCCAGGATATGGGTCATCATGAAGGGCGAGCGA
GGTAAGCTGGGAAAGAGATGGGGCGGATAAGATTCGCGATGTTCGCCTCTTCCGTTCACCAAACTGATTGTCGGCTTCCC
TCGGTCTAGAGTTCAGCGGTACTCTGGTAGGCTTTGACGACTACGTCAGTAAGTATCTTTCCGAATCATCTTCCATGCCA
AATGATGTTCTCAAGCTAACAGCCTACAGACATGGTGCTGGAAGAAGTGACCGAGTTGTATGTTGTACTGCGATACTGCC
TGCGTCATGTTCTGCTGCTGACCCGTGATATTGTAGTGACTACTCTGGTGGCCAAACCAAGATGTCCAAGATCTTGCTCA
ACGGCAACAACATATGCATGGTACGTACGCGACCCGCAAAGACAAGAGACGTCTGGCTAACTAGATCGCAGCTTATTCCA
GGCGGAGAGGGACCAGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62