GenePrediction:GLEAN_2458 Details

Name: GLEAN_2458
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1253086..1258013 (+ strand)
Length: 4928
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1253086..1255309 (+ strand)
Length: 2224
Type: CDS
Source: GLEAN
Position: GCSC_140:1255371..1256240 (+ strand)
Length: 870
Type: CDS
Source: GLEAN
Position: GCSC_140:1256351..1257120 (+ strand)
Length: 770
Type: CDS
Source: GLEAN
Position: GCSC_140:1257454..1257801 (+ strand)
Length: 348
Type: CDS
Source: GLEAN
Position: GCSC_140:1257864..1258013 (+ strand)
Length: 150
>GLEAN_2458 class=GenePrediction position=GCSC_140:1253086..1258013 (+ strand)
ATGGAGCGAGATCGTCTCCTGGTGCGAGAGCGAGAGCGCGACCGTGACCGTGACCATGACCATGGCGCCAGCAAGAAGCA
CAAGTTGGGTGTCGTCTCGGGCGTTTACGTGCCCGTCTGCCTCAGCATCCTCAGTATCCTCATGTTCCTCCGCTTTGGCC
TCATCCTCGGCCAGGTCGGCCTGTTGGGCATGCTCGGACTGCTGGGACTGTCGTACCTCGTCGACTTTATCACCACGCTC
TCGCTGTCGGCCGTGGCCTCCAATGGCGAGGTCAAGGGCGGCGGCACCTACTACCTGATCTCGCGCTCGCTCGGACCCGA
GTTTGGCGGTTCCATCGGCCTGCTTTTCTACCTCTCGCAGGTGCTGAACACGGCCCTCAATGTTGTCGGTCTGATCGACT
GCATCTACCTCAGCTTCGGGCCCAGTCTGCCCCACGGCTACTGGGTCGGCTACCTCTCCCAGACGGCCGTCCTCGTCGGC
TGCACGCTGCTGTGCTTCGCCGGCAGCGGCCTCTTTGCCAAGGCCAGCAACGGCCTCCTCGCCATTCTCACTCTCGCTAC
TCTCAGCATCCCCATCTCGGCTCTCTTCCACGTCCCCTTTGCCGACCCTGTGCGCGGCATCGAGTTTACTGGCCTCCGTC
TGGCCACACTGCGGTCCAACCTGCTGCCTCACGCCGGCGACGGCCATTCCTTTGCCGGCCTGACGACTTTCCGCGAATTC
TTCGGCATCCTCTTCCCCGCCACCTCCGGCATCTTCGCAGGCGCCTCCATGTCTGGCGACCTGCGCAACCCCAGCAAGTC
TATCCCTGTCGGCACGCTCTGGGCCATGCTATCGACCTTTGTCGTCTACCTCCTTGTCATCCTTTCCCTGGCCGCCAGCA
CCACCCATGACTCCCTCCTCTTCCAGCCCAACATCATCCAGGAGACGAGCATCTGGGCTCCCCTCATCGTCGCCGGCGAG
TGTGCCGTCACTTTCTTCTCTGCCCTCATGGGTCTCATCGCCGCCTCCAAGCTGATGCAGGCCCTCGGCCGCGACAAGCT
CTTGCCCGGCCTCGCCGTCTTCTCCTGGGGCACCAAGAAGACCGACGAGCCGCTGCTGGCCCTGATGGTCACCTATGCTA
TCGCCCAGTTTGCGCTCTTTGCCGACCTCAACCAGATCGCCACCTTCATTTCTATGGGCTACATGGTCACCTTCTTCGTC
ATGAACCTGGCCTGCTTCCTGCTCAAAATCGGCTCCGCCCCCAATTTCCGGCCTGCCTTCAAGTTCTTCAGCTGGCAGAC
TGCCTTTTTCGGGAGTCTCACGTCGGCCGGTGCCATGTTTTTCATCGACGCCACCTATGCCACGTCTGCCGTTATCCTGC
TAGTCGTGCTTTTCCTGCTGATCCATTACCTGAGCCCGCCCAAACGCTGGGGTGACGTGTCGCAGAACCTGATCTACCAC
CAGGTCCGCAAGTACCTGCTTCGTCTGAGGCCTGAGCATATCAAATTCTGGCGCCCCCAGATAATCCTGCTGATCAACAA
TCCGCGGCGGCAGACCCGTCTCATCCAGTTTTGCAACTCCATGAAGAAGGGCTCGCTGTACATTCTGGGCCACGCCATTG
TGACCGACGACTTTGACACCGGCGTTTATGAGGCGAAGCTCCAGCATGCCATGTGGAACGAGTATATTAGCGAGTACTCG
AGGATCAAGGCCTTTGTCCAGCTGACCATGTCGCCGTCTATCACCTGGGGCGTGCGGAACCTGATCCTGTCGAGCGGCCT
CGGTGGCATGCGCCCAAACATTGCCGTGTTGGGCTTCTACAATTTGGATGAGCTAAGGGCTACGCAGCCCTTTGTGCCAA
TGCCCTGGCTTCCCATTCCGTCATTTGGCGCGGCAACGGCCACCCCGAGCCCAGATCCAGAGTCTCGTCCGGCAGCTGGA
AATGTTGGCGTGCCACGGCGGCGGCGGCGGGGAGACACTACATCGCGGATCCTCGAGGGAATTCTCCCGACAGACGTAAT
CAAGACCGAGGGCATGATGAAGGTGACCGAGTACGCGACCATCCTGGAAGACCTGGCCCTTCGCCACCGTATCAATGTGG
CCGTAGCCAAGGGCTTCCACACCCTGGAAACACCGCGACCTGACAGCAGCAAGACGAAAAAGTACATTGATCTGTGGCCC
ATCCAGATGTCAGCAGAGCTGGAAGCCGATGGAAAGAGCGTGTTGACCACAAACTTTGACACATGTAAGTCAGGCATCTG
CTAAATACACAGAAACTGTGCCCGGCTGACATGACGACTCGCTAGACACCCTCATTCTGCAGCTGGGCTACATACTTCAT
TCGGTTCCGGCCTGGAAGCAGGTGTACAACATACGTGTCATGGTGTTTGTCGAGTATGAAAGCGAAGTGGACGAAGAGCG
CGGCAGGTTGGAAGCGCTTCTCGAGAAGCTCCGAATCAGCGCCGAAGTTCACGTCTTCTGGCTGGCAAGCGGTGATCTCA
CGACCTACGAGACCATCATCCATGGCCGCTCCTCCGACCCATCGGCTGAACGGCTCGTGGACGCCGTGCTGAAAGACGAT
CCGTGGTGGGACGACATGAGACGGACACGTGGCAAGGCTTCTTCCAGCTCCCCTTCGGCGGCAGACGGCACGCCCAGCTG
CCGAGACAAAGTCACGCCGCGGATACGAAGGCCCAGCATGGTACATATCGAGGAACTACAGAAGCACAGCACGGTCTCGA
CGCTGGCTCGGCTGGGTCTCAGCATGGGTTACCGCACGCAAAACCTCGGCAGCAAAATTAGCGCGCGTTCGGAATACGGG
GATGTCATCGAGGACAACAGCAGCACCATGGACATGGACCCAGGCAACGATTCTTCGACAGACCAGAGCGACTTGGACCC
GGACTTTAACGATTCCGAGAGTGCTGCGAGCGAAGGCGATCTGGACGCGACAGACGGAACGGGTGCAGCCCGCCGGAAGA
GCCATTGGGACACGATCCTCCGGCGGTCGACTCTGCGGGGGAAGAAGATGGACGATAAGCGGAAGTCGCCAATGTCCAAC
TCGTCCTCGGCAGACCAGACGCCGCCATCAGTAACTCCACCCGGAAGGAACTACGGCACAATGTCGACAACATCTCTGTC
GTCGGCAGATGCCGCTGATCTTTGGGCCCGGCGAAGTCTGTTTCCGGGACAAGGAATGCAATGCATGTCGACCAGAAACT
CTCGTGTGTCCACTAGTTTCGTGCTTCCGTGTTTCTGTATCGCTAACCGTTTTCTTCCCATACAGCGCTTTCGTCCTCCA
TGCGGTTCTCCAGCAGCCTTGTGCCAGAAACGAGAACTGCTAACCCAGGAGAAACCGGCCGGACGATAATGTTTGCAGAG
ACGGCAGGGCCAGGGCGAATGGAAGACGCAACTCTGTCGCGGACCAATTCTCGACAAAGCCGCGGGGGCCTCACAAACAA
GTCAGGAGCAACAGCTGCAGGACCATCGGTGACGTTCGTCGAGCCACAGCGAGACCAGAAAAATGCACAGGCGCCTTTCC
GACCGCACTTGCTGCGGCACTCGTCGACACCGATTGTGCAGCTAAACAGCGGCGACGGGGCAGGTGACGACACGCAAAAC
TCAGCTGCAGATGGCCCAAGCTCGGGAGATGTGCGGATCGGGATCGCGGGTTTGCTCGCCGACTACAAGACGCGACAGCG
CGTGGATGGTGGAGAAGGCGGGAGCGGCGAAAACGGAAACGGCACAGAAAGCAGAGACAACGATGGTGACAGCATCAGCG
GAAGCACCGGATCGAGCTACGCGACACAGAGCTTGTCGTTGTCGTTCAACGACCTGCCACGGCGCGCACAGCACCTGATC
CTAAACGAGCTCATGCGGCAGCAGAGCACTGGGGCTGGCGGGAATGCAGGGGTCCTGTTCACGACGCTGCCGATCCCCGA
CGAGGGAACGTGTCGCAGTGAGACGGCCAGCCTGCAGTATCTGGCCGATGTGGAACTGTTGTGCCAAGGCCTGCCGCCGG
TATTGATGATTCTAAGCAACAACATGACGGTGACTGTGAGCCTTTAGGGGCAAGGGGCTTTGTCTGTAGCGCATCTGCTT
TAGGTCTTTTTGACAACTCTGTTGGGGAAACGGGCAAGTGCTGGGTCAAAGAAATGCATATTTTGGAAAAGCAGCAGCAA
CGTTTCCATGTGGCTCAGAACAAAGGGCGATGTCCATGTCTTTTCACGAGTCTCGTAGCCCCTGAATGTGCAGTACGCCG
GGTTTAATTTTAGACAGGCGCCCTTGTTCGGCAGGCTGAGTGCGGTCGAGACAAAAAGGCGCGAGAAGGCGATGTTCATG
GACAAGACTATTCGTGTTCACATCTTTACGACAGACGAGGATAAATAGCCAGGCTACGTGAGCGAGAGCCATATTTCGGC
TGTCTTCCAGAGACTCTCATTTCCCATGAAGAACCCACTAAACCGACACAGTGAGACCGCCAACAACCCGTCTGCCGAAA
AGGACAGCAGAGAAAGTGCCAGAGAGAACAGCAGCAGGGGATTTCGCAACTTTGCCCAGCGCCTACGCAGCCCGACTTCG
CCCAAGCCGACGGCAACAGTCTTCCAGCGGGTCCATCATCCAGACCGGCCGCCTGTGCCCGTTCTCTCGACTGACATCCC
GACCGAGGACGAGTGCCGGGTCTTGCTGAAGCAGACAGCGCGCAGTCCAGGCTTCAAGACGATCATCAAGCAGGAGGTAA
GTGAGCGAAGAGCAGATCGAGAGAGAGCCGATCACAACAAGACAGCAGCTATGGAGAGCCAGAAGCAGAAGCAGCAGAAG
GTGCAGCGAGCCGGAAGCGTGGTGGCTGGTCCACCAAGCAGGAAGATGTCAGTAGGGGCATCAAGAGCAACAGCACCAAC
ATCAGCATCGGCACAGAGATCGACACGGCCGCCGACGACGAAGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62