GenePrediction:GLEAN_2459 Details

Name: GLEAN_2459
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1258282..1259072 (+ strand)
Length: 791
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1258282..1258408 (+ strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_140:1258486..1259072 (+ strand)
Length: 587
>GLEAN_2459 class=GenePrediction position=GCSC_140:1258282..1259072 (+ strand)
ATGGCGACGCTGGCAGTAGCCGTCGATCAACCGTTGGTTCAAGGTCGCACTCGGGGACCAGTTCCGGTGGTGGTGTCAAT
TCCACGGCGGACGAGCTCGACAGGGGCCGTCAAGAGGCAGACAGAAGGTGAGAGACGGGCAGAAGACGAAAAGCTGGCAG
AAGGTAAGAAGACGGAGATGACAAGAGAAAAGGTACGGCAGCAGTACGAGATCCACCAATCGAGACGGATCGCCTGGTCG
CCGCTGGCAGCATCTTCCGGCTTGAGCGACTGGGCGACCAGACAGCCTCATCGACAGCGTCGGAACAAGACGTGGCTGTC
GCGGCAGCAATCGCCGAGGCCGAGGCTGAGAGCGGCGAGTCGCTGCTGGAGTGGGACATTGAGGTGATCAAGGCAAGTGT
GGAGGGCAGCTGGCGAAAGCAAAACTGTCGTCAGAGGAGCGCAATGGCTAATCAACGGGCAACGGCTGCTGGCCCGACAT
CTTCGCCGTCGACGAAGCCAACAGCGACGACGATGACGGCAAGGATGTCGGCCACGGCTTGCCTCTTGCAGTGTCTGACC
AGCGTTCCGCCTGAGGTAGCAGCCAGAGTGGGGATCGTGACAGTCGGCGTGGTGGCACAGCCGTCGAACGTGCGGATCGA
GCAGGCAGCAACACGGACGAGCTTCGCGCTGTCGGGCAATTCGAACGATGCGTACGACGACGATGATGAGATCCAATCAC
AGCACGGCGAGATGCTGGAGGGCTGGACTGGAAGCGAGTACTATTTCGAGGGAGGTGGCAGCAGGAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62