GenePrediction:GLEAN_2460 Details

Name: GLEAN_2460
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1261412..1264668 (+ strand)
Length: 3257
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1261412..1261737 (+ strand)
Length: 326
Type: CDS
Source: GLEAN
Position: GCSC_140:1261801..1262006 (+ strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_140:1262065..1262138 (+ strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_140:1262193..1262229 (+ strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_140:1262297..1262661 (+ strand)
Length: 365
Type: CDS
Source: GLEAN
Position: GCSC_140:1262734..1262851 (+ strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_140:1262909..1263009 (+ strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_140:1263065..1263180 (+ strand)
Length: 116
Type: CDS
Source: GLEAN
Position: GCSC_140:1263243..1263278 (+ strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_140:1263353..1263549 (+ strand)
Length: 197
Type: CDS
Source: GLEAN
Position: GCSC_140:1263624..1263733 (+ strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_140:1263791..1264381 (+ strand)
Length: 591
Type: CDS
Source: GLEAN
Position: GCSC_140:1264624..1264668 (+ strand)
Length: 45
>GLEAN_2460 class=GenePrediction position=GCSC_140:1261412..1264668 (+ strand)
ATGTCGAACAAGTCCAAGATGCCGGCATCTTCAGAAGAGGTCACTGAGATTTCGGTCGTCCGTCTAGATCTGTTCGACCA
AGACCTGGAGAGCCCGGGCGATGGAGAGAAGAACGGCCCGGTTCTGAGGTCAGAAGCAGTGCCCTCGCCAGACAGCGACA
AACACGAGCCCGACTTCTCGGCTGATGAATTCGCCCATATCCCAGAGCTCGTCCGCGAGGTGGTCCGTTTCGACGACGAC
CCGGATCTGCTCGTCATCACCTTCCGGTCGGTTATCCTGTCGCTGGTGTTCTGCGTCATCGGCAGCTTTGTCTCGCAGCT
GTCCTAGTGAGTTCTCTCTCGGCTCTCGGCTCTCGTCACGGCTGTCCCTTCTGACCTGTCCCCTGGCAGCTTTCGCACGA
CAACGGCGCCGTTCCCCGTCTTCTTCGTCATCCTCGCTTCGGCCCCTCTCGGACGCTACATGGCGCGCATCTTGCCCGAC
TATCGGGTGTCTCTGGGCCGGTGGTCCTTCTCCCTGAACCCCGGGCCGTTTTCGATCAAGGAACATGCCATCATCGGCAT
AGCCGCAAATGCGGGAAGCCAGGGACAATGGGCGAGTGCGTGTCTCCAAGAATATCCCTGCCGTCTTGCCCAGCACTAAA
CTGTCCCTTGTAGCATACCTGCCCACGAACGCCGCCCTGTACTACGGCATCACCATGAACCCGGCCGTTGCCTTGTTCTT
TGGCTGGGTCCGTTTCCAAGCCCTTCCCATGTGAACCGCACGCATAACTGACAGCAGACAGGGGGCTTCCCTGCTCGGCT
TCTCGTTCGCCGCCATGGGTATGGAGGGAAGGGCCAGAGAGGGACAGACCGAGACCGAAAGAAGCAGTAGCTGATACCTT
TTCAGTGCGCAAGATTCTGATCGACGACCCCGAGTTTATCTTCCCGCTCTCGCTGCAGCAGGTGACGCTGTACCACAGCA
TGCAGAGCGGCGTGCGAGCCCGCGATCGGCGACGCATGCAGGTGTTCTGGCTGCTGTTGGTGGGCACGTTTGCGTGGCAG
TTCTTGCCCGAGTACGTATTCCCGCTGCTGGCCTCGCTGGCGCCTCTCTGCTGGTTTGCGGCCAAGAGCCACAAGGTCAA
CTTCCTGGGAGCCGGTCGCGGCGGCGCAGGCCTGCTCAACATCACGCTGGACTGGTCCAACATCACGTCGACTGTGGTCA
CGTATCCGTACAGCGTGCAGGTGGTGGTCTTTGTTGGTTTTGTCATCACGGTGCGTCTGTCCGAGGAGAGTCGGTAGAGA
GCAGGGAAGGAAAGTCAGACAGACTGGCTGACAGAATGCAAGACCTGGATCCTCATCCCAGTGGCATACTTTGGCAACCT
CTGGGGGTCGCCGACGTACAACATCATGTCAAACGGAGTCTTTGCCAAGAACGGGACCAAGTATCCGGTGAACTACATGA
GTGAGAACTGTCCTTGTGAAAGACCTCCTTTTTGAGACCCAGCCTGACCACTCCCAGTCTACACGGACAGCAAAGGCATG
CAGCATGTGAACGAAACGCGGTTTCACGAGGTCGGGCTCGCATACTCGGGCGCACAGTATCTATGGGAGATCTTCATGGT
AAACTCGAGAGCGGGCAGCCAGCAGGATCGGACAGGTGCTAACGACAACGCAGTGGTATGCCTCGTACATATCCTCCTTT
GTCTGGTGCGGCCTCTTCCTTGCACCCAAGCTCAGGGCGATGTGGAAGGCAAGACGGTCTCTGGACAGCTTCCATACCGA
TCGTTTGAGGTGCGTCTCCGCTGTGAACATATTTTCACGCAACATCGCCTGACCATCATATCTGGCTCCAGTCGAATCAT
CCAGAAGTATCCGGGAATGACGCTGTGGTAAGTTTCGTTCTGCCTGTTCTTCTTTTTCTTCAAAGAACTTGACCTGTCAC
GGTATTCTGACGTCTCAACAGGGAATGGGCCTTGTTGACCATCATTCCCATCGTGATGCTCTTGGTCATTGTGGCCACAG
ACAAAGTCTGGATGCCTGTTTTCACGTACTTTGTCGCCCTGGGCTTCGGTGCCGCGGCTACACTGCCCATGAGCCTCGTC
TACGCCATGTCGGGGTACTCGATCAAGGTTGGCCTCTTCAACGAGCTGATCTATGGCTGTGAGTCTGCGTTGTGGCCACG
AATGAGGCTCCCGCTAACAAGAACTCTCTCTCTTCTCGTTCTTCCTCACCAGACATGATCGAAACCAAAGGTTCCTCTCG
ACATCCACTGGGCCAACTGGCATACCGGATCATCTCTGGCAATGTGTGGTATGACGCGCGGACGGTGCTCGAGGATCAAA
AGGTGTGTTCTTTGTCCGACCTTGTGCTCTTGTGCCCTCTGGCTTGACTCTCGGTCAAGATCGGTCACTACCTCCATCTT
CCACCGCGGACCGTCATCGGGATGCAGATTGTAGCCAACACGGTGGCGCTGCCGATCAACTACGCCGTGATGCGCTGGGT
GCTCGCGACCAAGTTCGACTACATCAGCGGCAAGAAGACAGATCCACAGGGCCAGTGGACGGGCCAGGACTTTGCCAGCT
ACAACACGGACGGCATCCAGTACACGCTCGTGGGGCCAAAGCGGCTGTTTGCGTCGCCCATCTTCACACCGCTGCTTTAC
GGCTTCCTGGCTGGCGGTCTCGCCCCGGCAGCCATCTGGCTGCTGCACCGACGCTTTCCGCGCGCCCGCTTCGACCTCTG
GAACACGACCATCTTCTTTGCCAGCGCGGCGACGTTCCGTGGAAACCTCAGCACAGGGCCGTTCACGGCCTTTCTGGTCG
GCACGGCCAGCAATCTGTTTCTGTACCGCTATCGGCACGCGTTCTGGCGGCGCTGGGCCTACATCTCGGGGGCGGCACTG
GACACGGGCTACAATGCGAACCTGCTCTTCATCTTCCTCTTCCTCGGCACGACGGGGGCGGTGATGGCCAAATGGTGGGG
CAACGATGCCGTGAGTATTGAAAAGTGCTTTGCGTTGATGGGGTAGTGGGTAGACGCAGGGGCGAGGAGATGGGCGAGAA
GAAATGAGATACATTAAAGGAGAGAAGAGACCAGGGGAGAAAGAGACTGATTGGGAAGAGAGCTGCCTGAGGGTCTCTTA
TAAAAAACTGCTTGAACATCTTCAGCTGGGGATCTGTTTATTGGCAATTTCAGTTGTTGTACTCGGTACTCCGCATATTG
ATGTTTGTACAGAGTACGGAGTACGCGTACTCGGAAACTTATGGTACGGAGTACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62