GenePrediction:GLEAN_2464 Details

Name: GLEAN_2464
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1286689..1289158 (+ strand)
Length: 2470
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1286689..1287264 (+ strand)
Length: 576
Type: CDS
Source: GLEAN
Position: GCSC_140:1287388..1287449 (+ strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_140:1287939..1288153 (+ strand)
Length: 215
Type: CDS
Source: GLEAN
Position: GCSC_140:1288216..1288299 (+ strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_140:1288350..1289158 (+ strand)
Length: 809
>GLEAN_2464 class=GenePrediction position=GCSC_140:1286689..1289158 (+ strand)
ATGAACCTCAACCTGTCGGCTTCGGTCAACGTCTTCCGGCTGCTGGCCCGGCCGTCGCTGTGCATGCCGCAGGCAGTCGT
GCCAACGTTTGGCGACCTGCCCATCCCGCTGGATGGGGCGTTCAGTCGCGCGCAGCGACCATCTGACGGTGCCCGCCCCG
ACATCCGCGCCGTCGTGCTCGACAAGGACGACTGCTTTGCCGAGCCGGACAGCAGCGCCGTGCTGCCGGCGTACCGCGAC
CATTTTGCCCGGCTGCGCAAGGCGTATCCGGGACGGCGGCTACTGATCGTGTCCAACACGGCCGGCGCGCTCTCGTACGA
CGGCGACGGCGCGCTGGCGGCCGCCGTCGAGCGCGACACCGGCGTGGCCGTGCTGCCTCACCGCACCAAAAAGCCCGGCT
GCGGCGACGAGATCCTGGCGTACTTTCGACAGCACCCCGAGACGGGCGTGACGGACGCCAGCCAGATCGCCGTCGTCGGC
GACCGCCTCACCACCGACGTGATGCTGGCCAACCTGATGGGCGGCTGGGCCGTCTGGGTGCGCGACGGCGTCGTGCCGCT
GGCCGAGAAGAGCATTGTGCGTGTTCTGTTCTTTCTCTTGGCTCTTGCTTCTTGCTTCTTTTCCCATGCTAACTCCACAG
TTCTCTCGAGCTGAGCGGAAGATTATCCAGTTCTTCACGGCTGGACTATGACACTACAGCTACACAACGTCCCCATCACG
AGAGCAGCTCGTCACTGCTCGGCAAACAACAACGGTGTTACGTATGCATGGATCAGACGAAGCAGCCTGGTCACCAAGAC
AGCTCGGAAATGCACGGCCTCTGGCAGCTCTTCTCTGACTGCACCAGCAGCTCCCTCCCGGCAGCAATATATCTCTTCAA
TCCTCTTCTCTCCGAGGCGGTGCCCTAAAATCGAAACAAATGAAAGAAGCCAAAGGCACAGGAACAACCCCTCAAAGCCT
TCTGCCACGAATCCGGCGTGCTCATCACTTTTCTCTGACCCTGACCGACGCAGCCTGCTCTCGCTGTCTTCGTAACACTC
CTAGACGAATGTAGGCAGAGCTCGCTTGCGGCTTCAGCGTCCTTCGCTCTTTCCCAGACGGGCATATCCAGACTGCTGCA
TCGTCTCTATAAATCTCTTCGCCGTTCCCCTGCAATTCTCTCTTCTATTCTTCCTCTCCCCGTTATCGCCACCCTCTCAC
CTCGCTCTTCAATTCAAACTTTCCTTGCGTCAGCCACACTCACCGAACAGGACAAGGCCGGTCTGCATCTGCATCATGGG
CGGCAAGGTCTGGTCTGACGAAGAGGAACGAGTCTTCTGGTCCGAGATCGTGCCCACGTCCAGCAAGCGACACCTGTTGG
CGAAACCCTACACCGACGATGCCAAGGGTTGGGAGTCGTTGCGCAAGGTGATGCAGGCCAGCATGGGTCGGCGAGCCCGC
CGCAAATACACGGCCCTTATGCTCTGTACGTCTCGCGGTATGGCCTCTGCACATTTTTGTTCTGTGCTGACACTACCACA
ACCACAGATGAGCACTATTTCCAGAACTCTGTGCTCGAGCGATTCTCGCCTAATGCGGCCAGATATGTCCGAGACTATAT
CAGAAACGAGCGTAAGTGTCATCGGCTTCCTGGAACATCGCTCCCGCATTAACCAGACCAGGATCCTCCACCGGTCAGGC
TCCGAGTGAACGCAGCCGCTCGGTCATGCGCTTCGTTCAACGTGGAAGCGGCAGTGGCCGACGTCCAAAGAACGCACACG
CGTCCCAAAGTCAGGACCTGGATCAGCAAGACGAGAATCAAGCCCATCGTCAGAACCGACCACAGCAAAATTCCAGTCGC
AGCACCCGGACGCTATCATCACCAGTGCCACGACAGCTGCAGCTGCAGTTTCCGCTACCTTTACCATCGTCGCCGATGCC
ACCACCTCCGCCCCCTCCAGCTCCTGTCCGGTTGCCCCCTCTGTCTGCCATGGAGTTGCCTCTGTATGTCTGCACCGAGG
AGTCGGCTCTCTGTGAGCCGGACTATGACTTCAACTTTCACTACAAGCAACCTACGTATGAGATGCCGCCCTTTGTGCCG
CCCTCGACGTACCAACCGCCAGACAACAAAGCTGCCGTGTTTACGGCTCCGATCTACACAGCTACAGCCTATGCGGGTGC
AATTCACGACGGTCCTGTCTACAGAGCTCCAGTCTCCCGGGCTCCTGTCCACGGTGTTCCCACTTACAAGGTTCCTTCCC
ACCAGACCCCGATCTCCCGGGGTCCCACGCCGGCCGACGATTCTCTGTTTGTGAAGCAGGAGGTGCCTGTGCCAGAGCCA
GAAGACTTCAAGGTCCCTGTGCATCGCTGCGAGGAGTTGCACCGCCAAGATCAGATGCGCTGGCACGGGGAGCTGCATCG
TCGTGAGAGGCTGCAGTACCACGATGAGCTGCAGCGCAGCAAGATGGTTTCTGGAGAGTGGTATGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62