GenePrediction:GLEAN_2466 Details

Name: GLEAN_2466
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1295050..1296609 (+ strand)
Length: 1560
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1295050..1295344 (+ strand)
Length: 295
Type: CDS
Source: GLEAN
Position: GCSC_140:1295410..1295622 (+ strand)
Length: 213
Type: CDS
Source: GLEAN
Position: GCSC_140:1295675..1296609 (+ strand)
Length: 935
>GLEAN_2466 class=GenePrediction position=GCSC_140:1295050..1296609 (+ strand)
ATGGCAGCAACTCTGTATCCGGACGAAAAGGGCGCGTATCACATGGTGGCCGACGTGGAGGCTCACAATGATAAAGTGCC
AACCCCAGCTCCAGAGGCCAGGCGGCACATGGCCATGCCGTCTGTCTTGGGCCGCGTCATCGTCCTGGTCGTTCTGGCGC
TGATTGGGCTCATGCACACGGGCTTCTACCGCTCCGCCGCCATGCCATGCATGAGCCGTCACGAGGCGGTGCCCCTATCA
TCGCTAAGCATCGCCGACCGAGTTGACCGGATCCTCTCGACAACGCCGCTAATTGGTACGGAATTGACCTCTGCAGTTGT
GTTTGTCTTGTGTTGTGCACGTGCTTACTGATCCTGGCAGACGGCCACAATGACTTTGCCATCTTCATCCGCGCGGCCTA
CAAGAACCACATCTATGGCGACGATTTCCGCAAGGGCTTTGAGAAGGACGGCCTGCCACAGCACGTCGATCTGCCGCGTC
TGCGGGCGGGCAAGAACGGCGGCGCTTTCTGGAGCGTCTTCGTGGGCTGTCCGGCGAACGGGACAGACTATTCCGACGAC
AACTACGCGGACAGTGAGTGAACCAGCAGGAAGCAACAGGCGTGCTAGCATGCTGACTCGCCCAGGCGTCCGGGACACGT
TCCAGCAGATCGACGTGGTCAACCGGGTCAAGGCGCTGTATCCGGACGTGTTTTCGCCCAGCGTCAACGGCTCGACGGCG
ATGGCGGCCTTTGCGCGCGGCCAGCTGATCTCGCCGCTAGGCGTCGAGGGCCTGCACCAGATCGGTAACAGCGCAGCCAA
CCTGCGCCAATACCACGCGCTGGGCGCGCGCTACGTCACGCTGACGCACAACTGCGGGAACCGGTATGCCGACGCGGCGC
TGTGGGAGGCGCCGCTGCGCAAAGCGCCGGCCGTCTGGGGCGGTCTCAGCCACGACGGCCGCCAGCTGGTGCGCGAGATG
AACCGGCTTGGCCTGATCGTGGACCTCTCGCACACGAGCGTCGACACGATGGTGGACGTGCTGGGCGGACGCAAGGTCGA
CGAGGACGCGCACTGGACCGGCTCGTTGGCACCTGTCATCTACAGCCACAGCAGCGCCTACAGCTTGTGCCCGCACCCGC
GCAACGTGCCGGACGACGTTCTGCAGCTCGTACGGGCACGCCGCAGCCTCGTCATGATTAACTTTGCGCCCGACTTCGTG
TCGTGCCGCTGGGACGAGCGATCGCGCAACGGAATCCCGTCGTTTGACCCGGCCAATTCAACGCTGGAACACGTGGCTGA
TCACGTGCTACACATCGGCCACCTCATCGGCTTCGAGCACGTCGGCTTCGGCAGCGACTTTGACGGCATCCCGTCGACGC
CACGCGGCCTCGACGACGTCGCCGCCTACCCCGCTCTTGTCGCCGAGCTGCTGCGCCGCGGCGTCAGCGATGCGGACGCC
GCCCTCGTCGCCGGCGGCAACCTGCTGCGCGTCTGGCGCGAAGTCGACGAGGTCGCCCTACGGCTGCAGGCCGAGGGTGC
CCCCGTGTTGGAGGACGACCTGCCGGAGATCCAGTGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62