GenePrediction:GLEAN_2468 Details

Name: GLEAN_2468
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1301525..1302862 (+ strand)
Length: 1338
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1301525..1301548 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_140:1301606..1302862 (+ strand)
Length: 1257
>GLEAN_2468 class=GenePrediction position=GCSC_140:1301525..1302862 (+ strand)
ATGAATGCACAGGTCTCCTTTTTGGTGAGCTTTCGTCTCATTCGGCTCCTTGTCGTGACTGGTCACTAACCCATATCCCA
GGAAGGCGAGCTCAGTCTCATCCATATCCCTCTCGAGCTGTACGCGACCTTTGTACAGCCGATATTGCACGTTCTTCTAC
CCCAGGCGCACAGTCTGTCGCTGGATGCAGAGGATGATAGTGCTCCCGACCAGGGCCTCACGGCCGACAACAAGCACAGC
TTTCTGAACATCAGCATCACTCCAGTCGAGTGCTCCATTGTCTGCCGCACCTACTGGGCCGAGAAGGTTTTCAAGCCACT
GGTCTGTGATAAGCTGCCAAAGGATGCTGGCAAGGCCGTGTCCATCTCGAAGAACTCGTATATCGCCCTGTGTGTCATGA
GCGGTGGTATGGATGCCGGCTCACGCGTTGTCGACCTGTCGTCGCCGCTAGCCCTGGCCGGGATTCCCATTTTTTTCGTC
ACGACATACTACTCTGACTTCATCCTAGTGCCGACCAAGGATCGCCACAGCGTGGTCCAGGCTTTACTTTCGCGCGAGTT
TGTCTTCTCTGAGATGGAATCGTCGTTTGTCTCCCACGGGACACTGTCGCATCAGGGGGGAGGTGGCGGTGGCAACAGCA
ACCGCAGAGGCAGCTCGGTCGGCAGCTCGATCAGCAGCTCAATCAGCAGGCTCGGTAGCAGCATCCTGTCGACCGTGCCG
ACAACACCGCCGCCGTCCAATGCAGCCGAACTGCAGGACCGCACGTTCATCCAACTGAGAAATCAAAACGTTGTACCCTA
CATCGTTCCAGATCTGCACGTCGCCCACTGCTCTGGCCATAGTACTCTCGACACTGGCCGGGGCGGCGGCTACTATTCGT
CCTCCCAGCGGCCATCGGCGAGCAGCGGCAGTGGGTCCGGCAGCGGCGGTGGGGGCAATCCACGGAGCTGGGCCGACACC
ATTGACGCTCGGCTGTACACCTGTCTGGTGTCAGCCATGGTTCTGCCTCCCAAATTCCTGTCCGTCACGCTGACGGAGCT
GGACCCGCCCTCGATGCTGCTGGACAAGACGCTGCTGCCCATATTTGGAAGCAGCGTGGTCGGTGACGTCGGTGGTGACC
TGGTTCCCATCTTTCTGGACCTCGTCAACCTGCCATTCGAAGCAACAGGTATCGTTTCTGGAGTGGCTGGCAAACTGGTG
TCGGAGTTACGCATGGCCGAGGTGCCAGAGCTCTCATATCTGTCAACGTCCAAAGCTGGCGCTGTCATTCTCGAGAGCGA
GCATGCACAAAAGGCTTTGCAGATATTGCAGCCGCTATTGGATCCGCAAGAGACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62