GenePrediction:GLEAN_246 Details

Name: GLEAN_246
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:518388..519858 (+ strand)
Length: 1471
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:518388..518478 (+ strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_167:518639..519540 (+ strand)
Length: 902
Type: CDS
Source: GLEAN
Position: GCSC_167:519610..519858 (+ strand)
Length: 249
>GLEAN_246 class=GenePrediction position=GCSC_167:518388..519858 (+ strand)
ATGGTTTCCAACTTCCGCACATACGAGGCGCAGAGCCGGCTCCTCGCTGCTGTCATCGCCAGCCATCCCGGCCTGAAGCT
CAACTTCAAAGGTAAGCATCGCCGTCAACCTCTTGGCCGTGATCTTGCACCGCCTGTCATGCCTGCTCTTTCGCTGTATT
TTCTGTATTTTGTCTCTTTTTCTGCTTGCCTCTCGTCTCGTTTGTCTGGGCATCCGTTGATCTGTTGCGCGGCCTGTTTC
TCGCATCGCAGCCATCACACTGCATTTCGGCTCAGATGTGACCGAGTCTGTCATTCGACACCGCTTCCGTCCCGTCAAGA
TGCAGGCCGAAGCCATCCGCAAGGCCGTCGCCCAAGGCCAGGATGCCAAAGAGCTGAGCGGCATCTTTTACGTGAATGAA
AAGGGTACGAGAGCAAGTGGCCTCAACCTGTCGGACTGCATTCCTGTTCCCTGCACCCTGTCGTCTCGTCCTCCGCCTTC
TGGCCTCTCGCTAACCTCGACAGAGATTGCAAAGTACTTTGGCGAATCCACGCCCCAGGGCATCGAGTTCCAGTTCCGCA
GCATCCGCAAAGACGCAAAGGCGCTGCGTGACGCCGTCGACAAGGGCGAGAGCCCGCTGACTGTGCGCAAGACTGCCCCG
ACCGCCAGCCGGAAATCCACTGCGGCATCCTCGCTCAAGCGCCGAACTTCGCCCGCCACAGGTGCTACCGATGCTGCCGC
CCGGCCGACAAAACGGACAAACACAGTCGCCGCCGTGGCGAAGCTCAGGAACGACCCCGTCTTCTCTAATGGAGAGGACA
GCAGCAGCCTGGGCGATGACGTCGACTATGAACAGCTGGACTTGACGCCCACCGCCACACCGACTCCCACGTCAAGAAGC
CTGCCGGCTGCCTTTCTTCCTGCGAGCCAGCTGCCAGTCTCGTCGCCTGCGCCTCCCATGACGCCCACGTCGGCAACAGC
TGCCTTGACGTCCGCAGCCTCCTCGTTCGTGCCAGACCTCACGCCCGCTGTCAGCTCCGGCTCCACGCCGTCCGAGAACG
ACACTCCCGTTGCCGACATCAAGTACATCAGCGGTGTCCGACAGCATCAGCAGCAGCAGGCCGGCGGGAGATTCTATGCA
GGCAACAACACTACCGGTCCAAATGGCCGCACTGTGTTCTGTGTCGACGATGACGACGACGATGATGACGACGGTGTCTT
TATCCTTAACACGCCCTCCAAGGTGCTCAAGGTACCCAAGACCGAGACCGTTGCTGCTTCTGCCGCGGCCGTCATCGCCT
CCACGAGCGACTTTGATAGCTGGCAGAGCTTCGGCCCCTCTGTCAGCCATAGCAACCCGACCGATTCGTTCCAGCTATTC
AATGTCGGCACCTCCTCCTGGGCTCAGGACGACGTCTTCTCGTCCAGCACTAGCCAGTCGTTCTCGCAGTCGATGTCGCA
GTCGTTTTACGAGAGCGAGGGCGCCATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62