GenePrediction:GLEAN_2470 Details

Name: GLEAN_2470
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1309713..1312238 (+ strand)
Length: 2526
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1309713..1312138 (+ strand)
Length: 2426
Type: CDS
Source: GLEAN
Position: GCSC_140:1312205..1312238 (+ strand)
Length: 34
>GLEAN_2470 class=GenePrediction position=GCSC_140:1309713..1312238 (+ strand)
ATGTGGCCTTCTTTCGCGAAGCCACTCCTGGTGGCAGCCTCAATAGGCGCGCTCTTCTCTTCGACTGCATCTGCGTTGAC
CCTGCTCAAGTCCAGCTCGCTGAACACCTGCCAAACCAACTCCGGCTTCACGGCCAGTCTGTTCAACGTCGTCTTTACGC
CCAATAACAACACGGCCAGCGTCGACATCGTGGCCGTGTCCTCTATCCAAGGAAACGTCATCTTCGACCTTGAAATATCC
GCATACGGCTACCAGATCATCCGCCGCTCTGTCGACCCTTGCGACTCCGGCCTTGCCGGCCTCTGCCCCATGACAGCCGG
CAAACTCACGCTGGAATTCAATTTGGCTGTCAGCGACGATGCGGCCAAGCAGATTCCCAACATCGCCTACACCTTCCCCG
ATCTGGACGCCAAGGTCAAAGTCTTCATCAACATGACCTCGGGCGACGATGCGGGCCAGAGCGTGGCTTGTGTAGAGGCC
CAGTTTTCCAATGGCAAGACGGTTGATCTCACGGGTGTCAAGTGGGCCACGGCTGTGGTGGCCGGCTTCGCGCTGGCCTC
GTCTGCTGTGGTATCTGGCCTCGGCCACTCCAACGCCGCCTCGCACGTCGCCTCCAACGCGCTCTCACTCTTCGGCTACT
TCCAGGCCCAGGCCATGGTCGGCCTGACCGGTGTCTCGCTTCCGCCCGCAGCACAGGCGTGGACTCAAGACTTCCAGTGG
AGCATGGGCATCATCCGCGTCAACTTCATGCAGAAAATCTTTACGTGGTACCAGCGCGCGACCGGCGGCACACCGTCCAG
TCTGTTCGACTCGCTCACCACCGTGTCCGTGCAGGTAGAGAAGCGGTCGTTTGACAGCTCCACGTCAGCCTTGGACACGC
TGACCGGCTCCTATGCCGGCATGCCGCGCTCCGTCGCCATGATGCCGCGTTCTGTCGCCCGGATGCCTCGTTCCGTCGCC
CGGACGGCGAGCAGCGCGCTGTCTACCATTGCCAAGCGCGCCAATATCGAGGTCAACGGGTCGGGCAGCTATGTGGTGTA
CGGCATCCAGCGCGTGGCGTTCCGCGCCGGCATTGAGTCGACCAATCTCGTGCTCACTGGGCTTACGTTCTTCGGCGTCT
TCATCGTCTTCGTCTTCGTCGGCGTGGTCGCCTTTAAATGTTTCTGCGAGATTGCGGCCAAGAGACGCTGGATCAAGGCG
GACACCTTCCTCGACTTTCGCAACGGTTGGATGACCGTGCTCAAGGGCATTCTCTACCGTATGTGCCTCATCGGCTTCCC
GCAAATGACGATTCTCTGCATGTGGGAGTTCACACAGGTCGACTCGGCCGCCGAGGTCGTGCTGGCCGTCTTCTTCTTCT
TCGGCACCCTGGCCACTCTCGTGTGGGCGGCGTCCAAGGTGATCCGCATCGCGCGCCGCTCGGTGACGATGCACCGCAAC
CCTGCCTACATCCTCTTCTCCGACCCGCAGGCGCTGAACAAGTGGGGTTTCCTGTACGTGCAGTTCCGCGCGTCGGCCTA
CTACTACATCGTGCCCATCCTCATCTACACGCTCGTCAAGGGCATGTTTGTCGCCTTTGCGCAGTCCAAGGGCACGGTGC
AGGCGATTGCGTTCCTGTTGATTGAGGCCGCCTCCCTGATCTCGGCCAGCGTGCTGCGGCCGTGGATGGACAAGAGCACC
AACTCGTTCAACATTGCCATCTGTGTGTTCAACCTGCTCAACGCCGTCTTCCTGCTCATCTTCTCGGACGTGTTCAACCA
GCCAGACATTGTGACAGGTGTCGTCGGCGTGGTGCTCTGGATTGCCAACGCCGTTTTCTCGTTGGTGCTGCTGATCATGC
TCATCGTGTCGACAGCAATGGTGCTCTTCCGCAAGAACCCGGACAACCGGTACCAGTTCATGGCCGACGACCGCGCCTCG
TTCATGAAGTCGCAGACCCAGCTGACGACCACGACGGAGCTGGACGCATTGGCGGCCACAGCCCGCGGCGACAAGGGCGG
CTACAAGTCGGGTCTGGATCTGGACGACGATAGTGCATCGATCTCGTCCGAATCGATTCGCCGCCGCACGGATTCCAGCC
ATCTTAACGCTGTACCGGCAGCATCGGTCAACGGGTCGACACACAACAGCTACCGTGATGCACCGCGGTCGCCCGTGGAC
CCGTCGATGCCGCTGTTTCCGGCCGACGGCAATGCGAGCGGCCGGATGATGGGCTCGTCGCCGCCTGGCGGTTACGAGTA
CGACAACGCCGGCGCCGGTAACTACAGCAACAGCGCCAACGGCAGCTACAACCGCGTGCCGACAGCCGCTAACCTTGCGG
CTGCTCGCTCGGCCAGCCCGTTCGAGGCCAACCCGGCCACGTCAAGCACGTTCCGGTCGCAGAACAACTCCAGTCCTTCG
GGATTCCGGTCACAAAACAATGCTAGGTAAGCGCCCTCTGGACTGAGTTGTCCTTTGTTTTTTTTGTTTCAGAATGCTGA
CTCATCATACAGCCCATGGCAGCGTGGTGCCGGTTATGACCACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62