GenePrediction:GLEAN_2471 Details

Name: GLEAN_2471
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1323706..1327081 (+ strand)
Length: 3376
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1323706..1323900 (+ strand)
Length: 195
Type: CDS
Source: GLEAN
Position: GCSC_140:1323971..1324425 (+ strand)
Length: 455
Type: CDS
Source: GLEAN
Position: GCSC_140:1325048..1325206 (+ strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_140:1326215..1326472 (+ strand)
Length: 258
Type: CDS
Source: GLEAN
Position: GCSC_140:1326538..1327081 (+ strand)
Length: 544
>GLEAN_2471 class=GenePrediction position=GCSC_140:1323706..1327081 (+ strand)
ATGGCAACACACCGACGGTCTCTGGCGGCGGCGGCAGCAACGCTGGCCGGAGGTTCAGCGACAAGTGCCGAGAGTCTGGC
GCAGCGATCGCTCTTCATCCGCGTGCGGCCGGCACCGACGACGCTTTCGGAGCGGCGGTCTGTTCTGCGCGTGCTCGAGC
GGCATGGCAAGACGGAAATGTTTAAGAAGCTGGCGGTGCGTTGCAGCGGGATGGCGATGTCCAGGTGGTCTGGTGCTAAC
TTGCCCGTCTTCTTGTCTTGTCTAGGATAACGCCTCGTTTATTGCCATAGCCGCAACGGCTGCGACGGCGTCGACGCTGA
TCAACCGCAGTCCGATTCAGTACGAGTTTCTGTCAGAGACGTTTGAGACGGTGCAGCCGTGGGGGAATCCACGGGTGGCC
ACTCTGGTGCAGCCGATCGAGACGAGGCGGATAGGAGAAGGAGAGGTGGCGGAGACGGCGGCCGGAAGCGCCGACACGAG
TAACCGACGACAGACCGAACACGTGCAGCACAAGTCCTTTGTGGTCAGCGTGTTCCCCAGCCAAGACTACCGCCACCAGA
CGATGCTCCGGCTCTCGCCGCTGCATGGGCCGTGGCCCAAGGACTTCTCGGCCGTCTTGGCGCCGTCATTGACGGGCCGC
GGCAATGTCGCCTACAAGAACACGTTTGTGTACAACGCCCTCCGGGCGGTCGTGCCCGAAAGCGCGGCATCCGAGGGCCT
GTGCGACTGGCGGGCGAGCTCGGCCGACGTCAGCGTGCGGGCTGCGGCCACGAGGGAGAGCGAGAGCAGCAGCGGCAGCG
GCGATGGAAGCGGCAGCAGCAGACGCAGCGGTACCAAAGATGCGGCGTACATCCAGCAGCGCAAGGCGCGCAAGCTCCGG
TTTGACCGTTCGACGATTGCGGGCGTGCTAGCGAGGAGCAACAGGAGTAGCAGCAACAGCAACAGCAGCAGTGGCCAGAG
CAACAGCAGTAGTGGCAACAGCGACAGCAACAGCAGCGACACCAAGGACAACAGCAAGAACAGCAAGAGCACCGTTGATA
ACCAAGGCGAGGACCCCTTTAGCGTGTTGCTGGGCCAATAAACAGCGGGCCGACACCTCCTGACCGCTCGAACACCGTCC
TCGGCCAAAGGTGACGCTGGATCCAGTTTTGCTATCCAGCAGGCATCAACATCGGAGACATACCACGACAAGGCCCGGCC
TCGGCAACAAGGGCTCTGCAGTGTACTACCAATCGGCTGTCCGGGCTGAACACAGCTCTTGACCGGTGGAGAACACTGCA
TAGCTTGCAAACAGCCACGTCAACGGCGCTCGGCGCAGTTAGACACATAAGCCGTCTTCTAGGTCCAGCCGGCTCATGTG
CGACCCGTCGCGGCGCAGGATGCAAGGCCAAAATGCGGCGCCACGGGTGTTGCAGTCGAACTGGTGCAAGGGGCCCATTC
CGTTTGGCGGGCATTCTTCTGCCTCCTTGCATGACGAGATTGATGTCGTGTGCGAGTTAACGTGCGTCTTCCGTCAATAC
AAAGAAGCCTTGATTGCAAGCAAGATCCTGCGCAAACGCCATTGGTACGAAACAGGTACGAGCTCGTACTCCGGGCAAGT
CTGCTCCTGTGCAATCTGCATGATCTGCTCGTATCTTACATTTTTGAGCCCTGCTCCTTAGGCCGGATCAGGAAATGCAC
AGATGCGGTTCCCAAAAGTCACGCATTTGGCCTCTCGTATCCAGGCAGGAGGCCGCTGGGAACGGGTGCAAGCAGCGCGA
AGTTGGGCCGTTATTACGTCATCCGTGCAGAAGCCACGCCACGGGACAGAGAGGGGCTGCCGCAGAGAACTCGTAACGGC
AACCACGTTGCACTGCCCGCTGTCAAGCGGCGATGGGAACGTGTGGGAAAGAGTGGCGCTGCGCCCCCTCTCCATAATTT
TCCCAGGCTCTTAGTCCGCAAACGGCCAAGCCGCTGGACGATCCATTTTTGGGCGTGGCAGTGAGCAGGCCGCCTACGGT
AAGCTTTTCGGCTCTTGTTTCTAGGCCGCCCAGCGTCTCTGCTCTCATTCGCTGGCTTCCCACAGCCTCTCACAGCCTCT
CACACGCTCTCGCCCTCGCCCTCTCACGCTCTCACGCTCTCGCGCTTGTGACCAGCCACGTAATCAGGCGTGAGAGCCCA
GCAGCCGCGAGCAGAGGTTGACCAATCGAACGAGCAGACGGGCCAGAACAGGGAAGGACACGCTGGAAACGGGTTTGTCT
GCCGAAACTGCTGCATGACGTTGCACACCTGTCTTGCCTGTCTGACCGTCTGTTCTGGGCGGTCTCCATCGCGATGCCCA
TGGTGGCCATGACGCTCTAGGCGTCCACAGCCACTGACCGCTGGCTGGCCTGTGCCTGAAGCACGGCGCGCCTTCCAGCT
CCATATAATGTCGTCCTTCGCCTTCTGTCTTGGTGGGCCTCAGTCTTGCAGACCACTTGCGACTTGCGAGACCACTGACA
GACCACGCGCAATCACTACACTTACAAAGTAAGATATTTACCGGGAGCACAAATCTCTTCTCGGCCAGGCCTCTTTCCAC
CATGGCCCGCACCGGCTTCTTTCACCATATCGGCACATTCCTGCTCTTCGCGGCGTGCATCCTGCTGCTCGTCACCAGCA
TCTCGGCCCCGACCGTCAACCGGCTCTCGCTCCTCAAGGTCCGCCTGGGCAATGCCACCGAGGCCCACAGGTCGGCCCTC
ACGTTTGGCTCGTTTGGCTACTGCATTATCGACACGCCGTCCGCAGGGTGCGTCCAGTTTCCAATCCAGCCTTCCAAATG
GCTTACTAATCAACATCGCGTTTCAGTAGCAGCTCAAAGAATGAAGACTATTGCACCCACAGCAAGCTCGGCTACGACCC
GGTAGCGGCCATCGTGGCCGGTGGTATCGAGTCATCCTCGTCCTCCTCCAAATCCATCTCCACGCTCTTCTCCCACGGCG
AGACCAGGACGGTCCGCGACCTGACCAAGGTCATGATCCTGCACCCAATCGGCTGCGGCATTCTCTTCGTGGCCTTTCTG
TTCGCCGCCGGTGCCGGCTTTATAGGCTCGTTCCTGGCGTCGCTCGTGGCCCTGGTTGGCTTCCTGGCGACCATTGTCGT
ACTCGCTACCGACTTTGTGCTTTTTGCCATTGTGCGCCACAAGGTCAACGGCGACGACGACACGACAGGCGCTACGGCCG
TCTTTGGGCCGGCCATATGGACCGTGGTCGCTGCTGCCGCCTGCGCGCTGTTCGGTACCCTGATCGTCTTCTTCTCCTGC
TGCAGCGGCCGTCTGCACGAGCGGCGCAGCGTGCCGTCGCGCAAGCTGGAAGGCAGCTTTGCCCGGCCTCCGCGGCGGTG
GAGACGATTCATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62