GenePrediction:GLEAN_2472 Details

Name: GLEAN_2472
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1327608..1329034 (+ strand)
Length: 1427
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1327608..1327838 (+ strand)
Length: 231
Type: CDS
Source: GLEAN
Position: GCSC_140:1327895..1329034 (+ strand)
Length: 1140
>GLEAN_2472 class=GenePrediction position=GCSC_140:1327608..1329034 (+ strand)
ATGACTTGGGATCTTGCGCGTCGCCATGAGCACAACGTGCAGACGCTGCGACGGTCGCCGCTGGCCGAGATCTCGGGTGC
GCTGGGCGACCTGGGCACGCTGCTACCGCTGATGACAGCCCTGGCTGTGCAGCACTCAGTTTCGCTATCGTCGACGCTGG
TTTTTTCGGGGCTCTTCAACGTGGCCACGGGCATTGTGTTTGGCATTCCGTTGCCGGTGCAGCCGATGAAGGTGAGTGGG
AGCTGGCGACCGTTGTGGCATGCACACTTCAGCAGCTGACGGACTAGGCCATTGCTGCTGCAGCGATCGCGTCGCGGGCG
TCTCTCCGGGACACCGTCGCGGCCGGTGGTCTCGTCAGCGCGGCTGTGCTGCTGCTGGCGGCCACGGGACTGCTGCGCTG
GCTGGCCGTTCACGTCCCGGTGCCGGTGGGCAAGGGCATCCAACTGGGCGCCGGCCTGTCGCTGATCATCTCGGCGGGCA
ACAGCCTGCTTGGGCCGCTGGGCTGGCTGCAGCCGTCGGGGCTGGATAACCGACTGTGGGCGCTGGCTGCGTTTGTCGGG
CTGATGGCGACGCAGGGCTTTCGTGGAGGCCGATTCTTCCCCTATGCTCTGGTCACCTTTCTCGTCGGGCTCGCGCTGGC
TTTGGCGGTTGCGCTGACGGCTCACGCCGCCGACCACAATGTGCGTCTGCCCGGCTTTGCGTTGTGGCGGCCCCGCGTTC
TTCTGCCGCACTGGCTGTCGGGCGAGGCCTGGGGAATGGCCGTGGCGCAGCTGCCGCTGACGATGCTGAACTCAGTTGTG
GCCGTGAGCGCACTGGCGAGCGATCTGCTTGGCGGCTCGACCACGCCTGCCTCCGTTACCGCTCTCGGCTGCAGCGTCGG
CCTGATGAACCTGGTCGGCTGCTGGTTCGGAGCCATGCCGGTCTGTCACGGGGCTGGCGGGCTGGCGGCGCAGTACCGCT
TCGGGGCTCGTAGCGGTGCCAGCGTCATTCTGCTGGGTCTCTTCAAGACAACCTTGGGACTGCTGCTGGGCGAGACGCTT
GTCGACCTGCTCGGCTTCTTTCCGCGCGGCGTGCTCGGCGTTCTGGTGCTGGCCTCGGGCCTGGAGCTCGCCGCCGTCGG
CAACAGCCTCAATCAAGGCGCGCCCGATCTCTGGGAGGTGGCGGCGAATAATGTGAGAAATGAAGCCGCTGCAGCCACGG
CATCTGACACAGACACCCAAGCGAACCGCAAGCATCGCGCTCTCTCCGACGACGAACGCCTCGAGCGCTGGACTGTCATG
CTCACCACCACGGCTGGCATCCTGGCCACCAAGAACGACGCCGTCGGCTTCGCGGCCGGCCTGCTCTGTCATGGCGCATA
TCGCCTGGCCGACCACTATCGCCAAAGATGGCCGGCCGGTGGAGAGGGCCGACCGTTGCTAGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62