GenePrediction:GLEAN_2473 Details

Name: GLEAN_2473
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1329514..1334001 (+ strand)
Length: 4488
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1329514..1331344 (+ strand)
Length: 1831
Type: CDS
Source: GLEAN
Position: GCSC_140:1331483..1334001 (+ strand)
Length: 2519
>GLEAN_2473 class=GenePrediction position=GCSC_140:1329514..1334001 (+ strand)
ATGTTGCCAATCATATCGTCCCTTGACCCGTGGAGGAGTCCACCACGAAAGGCCCCACCGAAAAATGGACTCAGGCCGGG
ACATCCTGAATACCTCTTTTTCGATTGCCCGATTCTGCTCCCCAGCGGCCGCCCCTCCAGAGAAGTGCGCTGGTACTTTG
CGTTTTTTGGCAGCCCCGAACACGACAACGACACAGGCGAAGGAGCTGTTCCCAATACAGCGATGACTTCGCCCAACGCC
ACGCTCGACCTTCCCATCGATAACTCGATTGGCAGCGCCCTGCAGAACGACAGCACCACGAACACGAACTCCACGACGAC
CAACTGTGCCGACACGACGCAAGACGCGCCTGGCGCGACGTACGACGAGTCAGCGACATTACCGACGCCTCTGATCACTG
CTGGTGGTGCTTTGGCCGCGGGCAGCCACCTGTTGCTGGCCACCACAGACGGCTCATCAAACATCAACATCAATATCAAC
ACAACTATTGACCCCGACATCGACACGAACACAAACCAGCTCGCCCCTCCCCTGGATCTCTTTGCCGGCACTGCCGGGAC
AATCCAGAACGGCCTGATCCCCATGACCTATTATCTTGCTGGCGGCTCCGCCGGCGGCCAGTTCGGCAATGCCGACAACG
ACCACAAGCACTGCATCAACCCGCAAGACCTGGCCTCCTATCTGGACACGACCAAACTGCAGACGACCGACCACTTGCCG
GATTCCTCGTACTTTCCGAACACGACGTACAATGGTGCTGCTGTGGCGGCGGCGAGCACGAGGCCGTCCGGCCTGGACTC
GTTTGCCCGGCTCAAGTTTGCCGACGGCACCTTTTTCATGACGACGTACTCGGTCATCATCGGCCGCGACCAGCTGGCTA
TCGACCAGGCCCGTCGAGATCTGCGCTGCGGCACGGTCGGCGATGGCCTGCCAGCCATCAGCTTCCACGACCAGACCGAC
CTGCCGCAGCAACGGAAAAAGTTCAGCCGCTCCTACATCAGCGAGGAGGGCGGTATCATGGGGCCGGAGGCTGACGACGA
CCAGCCGGCGACCAGCCGTCCGGCCAAGCGGAGAAAGACGAACTCGGGCGAGTCAGCCTCGCAGCCAGAGGGAAGCAGAC
ACGGGAGTAGCGGTGGCGGACACGCCAGCGGGGCTGGTGCAGGTACAGGTGCAGGTGCAGGTGCAGGTGCAGGTGCAGGT
GCTGGTGCTGTACAGAACGGAAACGGCACAGACCACGGGGCTGCTGATGGCAACGATCATGCCAGCAGCAGCATCGTGCC
TGACCGCCAGTACTTTCCCGGCCACACGCCCAACTCAGCCATGGTGGACATCGAGACCCACCAGCCATCACCGCACCGGG
TGGCCTTTGTCGGGATCCACTCGCCCGGCCCTGATATGCTGGCCAAGACCAAGGCGATCTCGCGCAAGCATCTGAAGATC
TCGTTCAACTTTGAGAAGAGCGTCTTCGAGGCTGAGCCACTGCACATGAACGGCTTTTTCCACAACGACCAGTACGTGCG
GGACCACTCGGTCGTGCTGCGGTCCAACGATACGCTGCAGATCAAGGACATCGCCTTTGAGTTTGTCATCAGCACTGTCA
AGAAGGGCCTCACCGGCGCTGAATTGCTGCCGCCCAGAAAGAAGACCACCGGCGGCAAGCAGATGAGCTTTGAGTTTGAG
AGCCACCACGACGGCAACGTCCAGGACACGAGCGAGGAAGAGCCGCAGCCGGGTGCCGGTGCCGACGACGACGACATTCC
CGATATCAGCAGCAAGGGCAAGGGCAAGGGCAAAGGCAAGGCCAAGGCCAAGGCCAAGAAGGCGCCCAAGGGTACGAATG
TGCTGGATGTGTTGGCAGCACCAGCGCCAGCAGCTCCGGCTATGACATCAGCATCGACAGCGACATCTGTATCGGCACCA
ACAGCACCGCCAGCATCAGTACCCGCATCATCACATCCTCTCGCACTAGCATCCGCATTCGCCATGCCGGCAGCCATGCC
GACGGCGCTGCCATCCTACGCCGACGATGCCATGGACGAGGACCAGAAGCTGCTGATCCGGTCGATCGAGCAGGACCCGA
CATTGGCGACGCAGCAGCTCGCGGCCGAGATGGGCCTGCCGTCGCTGCCGACACTCAAGAAGCGTGGCCCGGGTAGGCCG
CCCAAGAACGGTTTCATGTCACTCAAGGACACGAAGAGGCTGCTCAAGGCAGCGGCCGATGGAAAAGACTCAGCCAACGC
CGCGGCAGCCGCGGCAGCTGTGGCATTGGTTGGGACGGTCAACGCAGAGGCTGTCTCAAACGCTGGCTTAGCGGCCATCT
TGGAAGCGATCCATGCCGACGCCAACAATAATGCCAACAGTATTGTCAACAACAACAACAACAACAACAATAGCGTCCTC
TTGTTGGGCAGCGGTGGCAGTGGCGGCTACATTGCGCCGACACAGAGTCCGGAGGCAGGTTTCGTGGCCACACCGGGCGG
CTCCTCTGCAGCTACGGCGTTTGACGGCACACCTGCAGCCACGATGAACATGTATAGCGGTGGTGGTGGTGTCAGTATAG
GTGGTGACTTGAACGGCAACAGCAACGCCAACAGCTCTAACATGCCGATGATGGGAATGGTCGGCGGGCCCTCGTCTGCG
AACACAGCAGCAGCAGGGCCACCGGTGAAGCGCAAGGTTGGACGTCCACGAAAGTATCCACTTCCGGACAACGCGGACCA
GCAGCCGGAGAAGCGCAAGTACAAGCCGCGGAAGCCACGAAACGAGGGCGACATAAACAACAGTGGCAGCGGCGGTGGTG
GTCACGGCGGAAACGGCGAAACGGACTCGGACGGCAACGGCGGTCACGGCCACGGTCACAACGGTCACGGCGGCGCGGAA
GCGCGGCGACATGAGCGGCACAAGACGCCGCCGCTGCAGCTCAACCGGGCCGACTACACGGCCGAGCAACTGGCCAAGCC
GAACAAGAACTACAGCGTACTGATCGACGAGGTGCTGCAGCAGGCGGCCAGCGGCTTGACACTTAAGCAGGTCTACAAGC
GGATCCAGGCACGCTACCCCTACTTTTTCTTCGAGGTCGAGACGAAGGGCTGGGAGAGCAGCGTGCGCCACAACTTGATC
GGCAACTTTGCCTTTGCCAAGATGGAGGACTCACAGCGATGGATGCGCGTCGACGGTATGTCGCTCGAGGAGGGAAAGCG
TCTGGCCTCGGCAGCCGCAGCCGTCCAGGCCGAAGAGAAGACCCGCGGCGGCGGTCGGGCAGTGAATCCGCAGCAGCAGC
TGCAGCAGCAGCAGCAGCTTGGAGGTGCTGGCGGCCAGTCACAGGTGCAGGCACAACTGCAGACGCAGACGCAGACGCAG
ACACCCACGCCGATGCCCACACCTACACAGATGCAGACACATGTGCAGGACCAGCAGCAGCAGCTATTTCAGATCCAACA
GCTGCAGCAACAGCAACTGGCAGACCCTCATGGGCTCGGACAGCTGCAGGCGCATCTTGGCGGATACCAGTCACAGCAGC
AGCAGCAGCAGGCTGGCCTTTCTGAAGATGGTGACGGCAAAGGCGGCCAACAGCAGCAGATGTCGCTTCCGTCCCAGAAC
AACGTGCTCTCAGCCGTGCATCAGCTGGCAGCAGCCAGCCAGGCCGAAACAGGCGGCAACGTTGCCGGTAATGCTGCATC
CGGGGTCGTACAGCCACAGCATACGTTCCAGCAAGCAGCAGTGCCACCGGCTGCAGCTGCAACAACAGCGCTAGAACAGT
CTCCAGCACAGCAGCCACAGCCTCTAGCACAGCAGCCACAGCAGCCGCGGCGAGTGCAGACCGCTGCAGAATACCAGCCA
CAGCTAAAGTACCAGCCACAAATTCCGCCACAGCAGCAGGCATTGGCGGTGGCACCCGAGACGAGCGTGCTGGTGCGCAA
CTTCAAGGCGCAAGTGCTCAAGCAGGCGGGCAAGCTGACGCCGTACGCGGAAGAGATCGCCATGTCGGTGGTGAACCGGT
GTCTACGGCTGTCATCAGAGAGCACGGCGCCGAACAGCGCGGATGGCGACGCGACAGCGACAGCGACAGCCTCGGCAGCC
AGCACGGCCAATCTGGAGGCCGTCATAATGCAGGTGTTTGAGAAGAGCCTGGAGCGGCAGCTGGGCGGCCGGCCGCCAAT
CAGTCCGGCGCTGCTGGAACAGCTAGTCCGAGTCAAGAGCACCTTTACGACGTTTATCGCAGAAAAGATGGGCCAGCGAC
GGGCCAGCATGCTGATTCTCTCGGCCATGGATCAGGTGCTCGGCTTCACCGACCGCAGCATGATGCACGCGGCCACCGAG
ACAGAGCGCCGCGAGATTGCCGGCTCCGAGCGGCTCATCCTTGATCACCTGCGCGATCTCGTCAAGGGGTTCAATCTGCC
GCTGACGCCGCAGCAGCAGCTGCAGCAGCAGGAGGTGGAACAATACCAGCAGAGGCTGGTCTCGTCAGCAAGGGCGGCTT
CAAACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62