GenePrediction:GLEAN_2476 Details

Name: GLEAN_2476
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1349182..1351023 (+ strand)
Length: 1842
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1349182..1349184 (+ strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_140:1349238..1349294 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_140:1349354..1349398 (+ strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_140:1349458..1349542 (+ strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_140:1349804..1350114 (+ strand)
Length: 311
Type: CDS
Source: GLEAN
Position: GCSC_140:1350184..1351023 (+ strand)
Length: 840
>GLEAN_2476 class=GenePrediction position=GCSC_140:1349182..1351023 (+ strand)
ATGGTACGTCGTCACGAAACGTGCAGGACCACCCGCAGACCGCTGACCGTGCGCAGGAGAGCCCCCACGAGCACCAGCAG
AACCTGCTGCTGTCCCGCATCATCACCAACGTGGTAGGCCGTTTCGGAAGTCAGACAGAACGAGCAAAGCTAACGTGCTC
GTCTCCCGGCAGGAAAAGCTGAACGAGGCCGTCTTGGTGATGAACAAGGCGCTTCAGGTTGGTTCCCTCTCCGACCAGGG
CGAAACGCTGGCCCAGAACTAACCAATGTGGCCCAGGATATTAATGTTCAGAACATGGACGTGGAGCTTGTGGCTCAAAT
GTTCAAGAACTACCGGTCCAACGTCCTGTTCCATCTGGAGGGTTGGTCTCTTCTTCTGCTCATACGATCCCTTACATGCT
GATATGGTTGCTTCTCTCTAGCTACCGACAACCTGACTGACCCGTCGTGACTGAGTTGCGTACGAGGGCATATCCATCTG
CAGGACGCTTTCCATTGTCCACAGCGGCCCGGAACCCCACTAAAGCGGCTCCGTATAGCGGCCACCCAAAATAAAATAAA
AATAAAAATAAAAATAAAAAATCCCGAATTTCAAGCTCTCTAACTGTAGATCCGCCGTCTAGAGGCGCCCATCTCGTCTG
TACAGAAACTACCGGCAGTCTCTCCCAGTGTCGCCATGTCGTCCACCGCTGCCTCTGCCTCTGCGGGCGCCTCGTCCTCG
TACACCATCTTTCCGCCGATCCCTGCCCCGCTGCAGCGCCTCTTTGACCTCGTCCCCCTCGTGACGTATCCAGCCAATGC
TCTTCCCGACGAGGCTCCAGACGATGAGCCGGAAGAGGCTGCTGTCGCCCCTCCGACGCTCTTTGTCTTTTCCAGTGCCT
CTGATGCGGCCCGCGGACGGCCTAGTTTTAATCCTACCTGTTTGAAGTGGCAGGTGAGTCGATTTTGCCTTGCCTTTTGT
CTTCTACTTTTCTGCCTTTCTCTCTCTCATTCTGACCTCTAGACCTACCTCCGTCTTGCCGGAGTCGCCGTGCGTCTGGA
GCCGTCGACAAACCACGCATCTCCGAGCGGCGCCCTGCCCTTTCTCCAGCCCCCCCGCCGACGTGGCCAGACAGCTGCCC
GGCCTGTCTCTGCCCACGAGCTGCAAGCCTACACCAAGAGGATGGCCGAAGAGACTGCCAGGCTTCCATCCTCCGGCCAG
GACGACTCCCGCGCGCTCGCATACCAGGCGCTCCTCGACACGTGCATCCGCCGCGCCTGGCTGCATGCCGTGTATCTGCA
CGAGAAGAGTGGCAGCAGTGGCCGCAGTGAGAGCATAGCCGCCCGGCTGTACGCACATCCAGCATCGACGTCTGCGCTGG
TTCGTGCGGCACTGGCACGGCAGCTGCGCATGGCAGCCGCAGCTGAGGTCTGGGGCGCCCAGGGCAGCTCTGGCGGCCAG
CAAACCGGCCACGAGACCGCGCAGATCTACCGCGAGGCTCAGGCAGCACTGCAGGCTTTGGCTACCTTGTTGGAGGACGG
CACAGAGAGACCGGATGAGACAGACGGCCAGACAGACCAGGCCGGCCCGTTCTTCTTTGGCAGCCATGAGCCGTCACTCT
TTGACGCGGCCGTGTTCTCGTACACAAATCTGCTGCTCGAGGACGACGACAACAACGCCTCGGCTCGCTTCCGCTGGCAG
GACCGCACGCTTCCAGACGCTGTGCGCGCTTTGCCAGCATTGGTACGACATCGCGTCCGCATCTTGGAGCGCTGCTGGCC
AGAGCTGGCGGCTGGCCAGAAGAACACGGTCCCGTCTTCAGTGACAACAACGGCCGATTCCATAACCTGGGTCAAGCTGT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62