GenePrediction:GLEAN_2479 Details

Name: GLEAN_2479
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1370356..1371719 (+ strand)
Length: 1364
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1370356..1370367 (+ strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_140:1370543..1370576 (+ strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_140:1370746..1371719 (+ strand)
Length: 974
>GLEAN_2479 class=GenePrediction position=GCSC_140:1370356..1371719 (+ strand)
ATGACGTCCTGGGTAACGATGTAAGCGGTGCGCTACGGAGTAGGTCTGAAATAGGAGCGAAGAACCTGTTTATTGTGCTG
GTGCTACGTAGTAAGTAAAGTAGCAGTATTTTCAAAGCATCTACGGAGGGTCTGGTCAATAAGGGCTGTGGGCCACTATT
TGTTTGATAACATATTGATGAAAAAAGATCGACGCAGAGGGAAAGAGAGAAAACAGGAGGAGTAAGTGACGAGATGCTAA
TGACACGGGATTAAAGGCTATCGAATGAAGACACCCGTCTTTCATTACATGGAAGTTGAACCTCGGACAACCACTGGACC
GTGGCAAAAAGGACGAGTATTTGTGCAGTATCACGAGGCACTCCTCATTTTCTCCGACACTCATGACAAGCCGTTCCCCG
GCATCGAGACCCCTCCGATGTTGCCATCCACTGCGGCGACCTGACGACAGACTCCGTGATTGCCGATTTCCGTTCCGCGC
TCGAGCAGCTCGAGGCCGTTCGTGCTCCCCTCAGGCCGGCCATCGCGGGAAATCACGACTTCACGCTGGACATTGCCATG
TTTCGGAAAAAGGCGGCAGACGCACGCCTGACAGACATGCCGGGACTAGTCGTCCGGACGTACGGCCACTACGGCGAGGT
GCGCGAGCTCTTCGAAACGGCACGCGAGCACGACGTGCATCTGCTCGACGAAGGCACCCACTACTTCACTCTTGCCAACG
GGGCGGTACTCACCGTCTATGCCAGCCCGTTCACGCTCTCTCTGGGCGACTGGGGCTTTCAGTTTCGCCCCAACGACGGC
CACGAGTTCGCCATTGCCAAGGACACTGACATCGTGATCACACACGGCCCACCGGCCGGCATATTGGACGGGACCGCCGA
CCTAAAGCAAGCTGGCTCGTCGGACCTGTTTGCTGCCGTGGCCCGAGCACGACCTCGCCTGCACTGCTTCGGCCATATCC
ATGAGAGCTGGGGCGCCAAGCTGGTGGCCTGGCGGGAGAGCATCAGCGCCGTGTCCTCCCACTTAACAGATGTGGAGAAT
GGCAGATCGACCGTCGTGGATTCTCTCCAAGGCCTCGGCTTCAGAACCGGCACGACCGAGGACAAGGAGGAGGCCGAGCG
GCTGGAGCAAAAGGAAAAACTGTATTCGGAAAAGGGATCATACTCGACGAGCCATTGCTCAGGAGACGATCACGGGATCA
AGCATGGCCAAAACACCCTCTTTGTCAACGCGGTCATAGAGGGAGACGAGGAGCATCCAATACAGCCGGCCTGGCTAGTA
GATTTAGAACTCCCAAGCCTTTTTACTGACGAGTCTGGGAACAGTGGCGGAAATGGTTCGATAGAACTGATGAAGGGTCT
CTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62