GenePrediction:GLEAN_247 Details

Name: GLEAN_247
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:523365..525046 (+ strand)
Length: 1682
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:523365..524079 (+ strand)
Length: 715
Type: CDS
Source: GLEAN
Position: GCSC_167:524133..525046 (+ strand)
Length: 914
>GLEAN_247 class=GenePrediction position=GCSC_167:523365..525046 (+ strand)
ATGCACGGCTGCACTGCTGGTGTTGCCGGTGTTGTCGACACTGCTGCTGCTGCTGCTGCTGACACTGCACCCACCACATC
CACTGCAGCCGGCCAATTGTCGTCGTCGTCGTCGTCGCCGTCGACCTCATCAGCCGCACCCGTCTCGCCAGCCTCACCAT
CCGCTGCTCGGTCGCATTCTTCCGCTGATCGGCTCTGCTCGTCTCCGTCTCCGTTGCCACCGACGACTTCACAACAACGG
CCGCTTCCGCTGTCGCTGCCATCGGCCCTGCTGTCAGCACATGTCGGCTCTGTTCCGACGCCGTCGTCTTCCTCCTCCTC
GCCCCCCCCACCCCCTCCTCCCACCTCGCTCGCGCCGCCCACCACTACGGCAGCCCCCATGACCAGCCTCGAGCGCTGGG
CGCTGCTCCGGTCCGACGCGCAGTTCAACGCTCTCGCCGGCGCTGTCGGCGGCTTCACATCTGGCGTCGTCACGTGCCCG
CTCGACGTCATCAAGACCAAGCTGCAGGCCCAGGGTGCCTTTGTCGGCCAGGCCGGCCACCAGTCGCACATGATCTACAA
GGGCCTCGTCGGTACCGCAAAGGTCATCCTGCGTGACGAGGGTGTCCGTGGCCTGTACCGCGGCCTGGGTCCGATCATCC
TCGGCTACCTGCCGACGTGGGCTGTCTGGTTCACGGTCTACAACAAGAGCAAGGTATGGATGGGTGAACGGTACCGTAAG
TGGTTTTTTCCCCTCCTTTTTTCACTCTCCTCCCCCTAAACCTCTCAGAAAACAACTATGTCATCAGCTTCTGGTCGTCG
CTCGTTGCTGGCGGCAGCAGCACCATCGTCACGAACCCCATCTGGGTCATCAAGACTCGGCTCATGTCCCAGATGCCGAG
CCACGACCATGACCGCTTCGCGGCCGCTCTGCTGCGCGGTGCTAACACCCCGACGTCGCGTCCGGCCCTGCACATGCCCT
GGCACTACCATTCCACCATGGATGCCGCCCGCAAGATGTACACCACCGAAGGCGTCCTGTCCTTCTACTCCGGCCTGACC
CCGGCCCTGCTAGGTCTGACCCACGTCGCCGTCCAGTTTCCGGCCTACGAGTTCTTTAAGACCAAGTTTACCGGCTACGG
CATGGGCAGTGCTGCCAGCACCGATGCTGCCGACGGTGCCGATGATGCCGACGCCGCACCCCAGTGGATCGGTGTCTTGT
CTGCTACCATCCTGTCCAAGGTCCTCGCCAGCGGCCTGACCTATCCGCACGAGGTCATCCGTACCCGCCTGCAGACTCAG
CGCCGTCCGTCTGCCACTGCCGTGCGTGCTGGACACGCTGCCTCTACTACACAGCTGGCCACCGGCATGTCAGCCGCCGG
CACCGGAGACGTACTCCCGCCCGGGGCTGCCCCCAGCCACACCACAGCACAGCCACAATCTCAGCCACAACTACAACCAC
CATCACAATCACAGCCTCAGCCTCAGCCGCGCTATCGCGGCGTCATCACCACCTTCCGCACCATCCTGCACGAGGAGGGC
TGGCGGGCCTTCTACGCCGGCCTGGGCACAAACATGATGCGCGCTGTGCCCGCTGCTACCGTCACCATGATGACGTACGA
GTACGCCATGCGGATGCTGACACGCACACGTCGTGAGGCCCAGAAGAAGCTTCACAGCACAGCGTACGGTGCGGCCAGCT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62