GenePrediction:GLEAN_2480 Details

Name: GLEAN_2480
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1379123..1379937 (+ strand)
Length: 815
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1379123..1379349 (+ strand)
Length: 227
Type: CDS
Source: GLEAN
Position: GCSC_140:1379430..1379540 (+ strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_140:1379628..1379937 (+ strand)
Length: 310
>GLEAN_2480 class=GenePrediction position=GCSC_140:1379123..1379937 (+ strand)
ATGGCCGCCTTTCGCCCCGTGAGCACGGCGGCAGCCGCCCGTCTTCTGAGAAGCAGTGCTGCCGTTCCGAATGTCCGACG
GCCATTGATTGCGGCCGCCCCGGCGATGCGGCGGTTCGAAAGCTCGCTGACTTCGGCCCCTGAGTCGCCGACTGTCTCTG
ACCCTTCAACATTGGCTACCTCCAAGAACCAGCCGGACTACGCCGCCCACTCTGACCGGGCGACTTCGTACGGGATTCCT
CTCTTTTTTGATGGCATGCTAAATAGGGAAATCTCTGACTGACACCGGGCTTCGACTGCCTCTTCAGAAAGTTCACTCCT
GTCCCAAAGCGCCTTTTGGACGGCAGCGAGGACACCGACGTGCTTCCGGCCGCCGTACTTTCCGGAGCTCCTATGGAACT
GGAGGCTCGCCAAGTCAGGTATGCCGGTTTTTTTCACCAAACATCTAGCTCTGTCTCCTTCTGTGATAAACACCAATATC
GACCACGGTGCTCATACAAACACAGAATCTACAAGCCCGCTAAGCCCGCAACGCAATCCGGTACCTGGGGCGGGTCTCAC
TGGAGGATGGACTGGGATGTCCTGAGCAAGGGCCACCGGTGGGAGAACCCGCTGATGGGATGGCAATCCTCTGCAGACTT
CATGCAGGGTACGCACATCAACTTCAAGAGCAAGGAGGACGCCATTGCTTTCGCCGAGAAGCAGGGCTATGAATACTTTG
TTCAGGAACCGAAGGAGCGCAGTTTCCGGCCCAAGCAATATGCCAGCCAGTTCATGTACTCCGACAAGAAGTTGAAGCAG
GTGCGGACAAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62