GenePrediction:GLEAN_2481 Details

Name: GLEAN_2481
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1382249..1384114 (+ strand)
Length: 1866
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1382249..1382419 (+ strand)
Length: 171
Type: CDS
Source: GLEAN
Position: GCSC_140:1382490..1382567 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_140:1382651..1382700 (+ strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_140:1382982..1383008 (+ strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_140:1383073..1383151 (+ strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_140:1383210..1383279 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_140:1383337..1383568 (+ strand)
Length: 232
Type: CDS
Source: GLEAN
Position: GCSC_140:1383649..1384114 (+ strand)
Length: 466
>GLEAN_2481 class=GenePrediction position=GCSC_140:1382249..1384114 (+ strand)
ATGATTCCTGGAGCTATAGATCACACTATCGCCAACAAGGCATACTATGAGCCGCCATGGGCTGATGTCAGTATCATTGG
CATCGCTGGCAGTTCTGGCTCTGGAAAGTCCAGCATTGCCAGAACCATTGTCAGCCAGCTGAACCTGCCATGGGTTGTTA
TTCTTTCTATGGTATGAGCTACCATATTCGTCTGTAGGAGAGCATCGCTGACAGCATGATCAAACTGGGCACGCGCTACA
GGACTCATTTTACAACAGTCTTGACCCAGAGTCGTCTAGGAAGGCATTCCGAAACGATTTTGACTTCGACTCTCCCAGCG
TACGAAACCCCCTTTTCTGCGTCTATCTGGATGACTAGCGTCTTAATATGTCAGAATTTATGAATACTGACTCAAGGTGC
AGGCAATCGACTTCGATGCTCTGTTAAAGACGCTTAAGGAGCTGAAAGCAGGGTAGGCGTCACCATGCATTCACACTGAC
AATGTCGTATGAGTTGTATGCTGATAATATAATAGGAAGCGGGCCGATATCCCAGTATATTCATTCGCAGAACACAAGCG
TTTAGACGAAACCACCACTATCTATTCACCGCATGTCTTGATCCTTGAGGGAATTTTGGCACTGTATGATCAAAGGATTT
TGGACATGTTAGACATGAAAGTCTGTTTCATCAATTGGAACCAAATTTAAGGTTCCATGCAGCTAACCACTAATCAGATC
TTCTGCGCTGAAGATGCCGATGTTTGCCTCTCGAGACGAAGTATGTAATTCCCTCGCATACATCGACTTTGTGACGCCAG
CTAAACTCTAAATCAAGTCCTTAGAGACGTCAGAGAGCGTGGACGTACTGTTGAGGGCGTCATTAAGCAATGGCTCAAGT
TCGTGAAGCCTAACTTTGTCAAGGTAAGAAGCGACCCTTGAAACCGCGCTGCTATTAAGAAGGCTAACAGTTGCATGGTA
GTATGTCGACCCACAGCGATCTGTTGCCGATATTATCGTGCCCCGCGGGATTCAGAACAAAGTTGCCATCAGTACGCTAT
TTGGTGTCATTGCCTCTTCTTGCACGCTTGTTTCCTGACCGGTTCTAGGCACGGTGGTGCAGTACATTCAGCAGAAGCTG
TTAGAAAAGTCACTGCAGCACCAAACTAGCCTGACGAGACTGCAGCTCGAGTCACTAAAGAAACCGCTCTCCGAGCGAGT
TGATTTCCTTCCGGAAACGCCTCAGCTGCTCGGAATGAACACTGTCATTCACGACACATCGACGAGCAGCGAGGACTTTA
TCTTCTATTTTGATCGCGTGTCCACCCTCTTGATTGAACTGTGCGTATACGATACCCCATTTGCGCTTGCTATAGACCGA
TACTGACACGCTCCGTTCCAAGTGCTCTTAACAATGCCAGGTTCTCGGAGGCGGTCGTCGAGACCCCCCCAGGCTACAAG
TACCATGGGCTTCGGCCGTATGGAAAGACTAGCGCTGTTGTTCTGGAGCGCGGCGGTGCTGCACTCAAGACTGGTCTCCA
GCGGGTCATTCCCGACTGTCGGATGGGCCATATCCTGATCGAATCTAATGTGCGGACGGGCGAGCCGGAGCTGCGGTACC
AGAAGCTTGCGCGGGACATCGACGAGCACTCCACTGTGCTGTTACTCGACGCGCAGATGTCATCGGGCGGATCGGCATTG
ATGGCAGTGCAAGTTTTGCTGGACCATGGTGTCACCCAGGACCGCATTGTGCTGGCGACGTACTCTGCTGGACGCATGGG
GCTACACCGATTGACGAGCTGCTTCCCTAAGATTGCCGTTGTGGTGTGCCACCTGGTGGAGGACATTGAGGAGCGCTGGA
TCGAGAGACAGTACTTTCGCTGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62