GenePrediction:GLEAN_2483 Details

Name: GLEAN_2483
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1398768..1403910 (+ strand)
Length: 5143
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1398768..1399478 (+ strand)
Length: 711
Type: CDS
Source: GLEAN
Position: GCSC_140:1399530..1400602 (+ strand)
Length: 1073
Type: CDS
Source: GLEAN
Position: GCSC_140:1400798..1401313 (+ strand)
Length: 516
Type: CDS
Source: GLEAN
Position: GCSC_140:1401369..1403910 (+ strand)
Length: 2542
>GLEAN_2483 class=GenePrediction position=GCSC_140:1398768..1403910 (+ strand)
ATGCCGAATCCAGTGGCACGCATCCCAACACAATCGCCAGTCCACGCACCGGCAGCGGCGCAGTATTCCTGTCTGCTCTG
CAAGCAGCGGAAAGTGCGCTGTGACCGGAAGATGCCGTGTTCAGCGTGTGTGCAGTGGAAGGCCGAGTGTGTCCGGACGA
CTCGGGCACCTTATACGCATAGAAAACGCCAGCGGCAAAGCGGGACTCCAGGGGAGATCCGAAGAGAGTCTACAGAGCAG
CCAGCGTCTTCATCTGCACAGGCAGCTGGCCAACCACACGTGCCGGTGCTTGGCGAGTACGGAGGTCCCGTGCTGGCAGA
TCCATCAGGTCTTCTATTTGGCGGGATAGTGGCCGACATTGAGCTCGAGAGTGCTCACCCACAGCCGGTGCAGACTTTTG
TGCTCTGGCAGACGTTTCTCCAAAACGTGAACCCCCTGTCCAAGGTGATCTACGCTCCCCAGGTGCAAGACTTGGTTGTG
CAGGCCGCCGCAGACTTTACGGCCGTGCTGGTGCAGACGGTTCCGCTCTTGTTCGCGCTGTATGCAGCTGCTGTGGCATC
CTGGAGCGAGGCTGAGTGCCGGGCCAAGATGGGCGAGCCGAAGCAGGCGCTCCTGCAGCGATACCTGGCAAGCACGCAGC
AGGCACTCACAGCCGCAGGCTATCTGCACACCAACAGTCTCGTGCTCCTCCAGGACTACACCATTTACCTTGTAGGTCTC
TGTCTCTGCAGCGTGGCCAGCCCCCTTTGCTAATGGTTGCAGTTGGCCGCTCGCCAGGTCTTTGACGCCAGTTCGATGTG
GATCTTGACGGGAATCGGCCTGCGCATGGGGTCACGACTGCTGACGACGACGCCGAACGCAGCAAACGGGTCGGCCTTGT
TCGAGACAGAGATGCGGCGACGGGTCTTCTGGCAGATGCTGCTGATCGACGGCCGGGCCGCACAGCTCTCGGGCCAGGGG
CTGCAATTTGTGGACGTGCCGGCGGTGCCACTGCCAGCGAATCTGAACGACAGCGACATTAGCCCGCAGATGGCGGTCAT
GCCACCGGCAGTGACGGACCGGGCGACCGAGATGCTGTTCTGTCTCATGCGCTACGAACTCTGCCAGTTTCTGCTGACCC
ACGGCCGGGAGTTGCACGACCCAAAAACGCCGATGGCACGGCGTGACAGACTCATCGACAACCTGGCGGCGATGTACGAG
AGCGCGTACCTGGGACATGTCGACGCGGCGCTGCCAATGCACCGGATCGCGGCGACTAGCACGAGCGCGATGCTGGCCAA
GATGCGCCTCACTGCCCACCACCCGAGCCGGCGGCCATCGATGCCGCAGGCCGAACACGACACGCTCTTTGCCACGGCCG
TTAGAATGGTGGAGACGCTCCTACGTGGGTTGGATGACGAGAGCGTGGCGCCGTTCCGCTGGCACGCGGACATGTGCTTG
CAGCTGGACGCGGTCATCTTCTTACTGATCGAGTCCCAGAGCCAGGCGCCCGAGGGCACGCTGGTCGACACGACCTGGCA
GCTCGTCGCGGACGCGTTCCGCCATCGGCCCAGTCTGGCCAGCGGCACGGACGAGATAAGCAGGGCGGTGCGGCAGCTGG
TGCTGCGGGCGTGGGAAGCCCGCGAGCGGAGCGCATGCAAAGGCGGACTGAAAGTGCCGAATTCGACAACACTGATTGCA
GATCTGCGGGCACAGGCGCAAAAGACTAGCATCGCCAGTGCAGAGGAAGATATTGGGGCAGAGCCAAACAGTAGCCTGGA
CAGGTCCTATGCAGACGATTGGGAGTCCTGGGATTACTGGAACACGTTGCTGCAAGGCGAGACGGTTGTATCGAGGTAGA
CAGAGTACGAGTAAAAGTATCTTGCGGAGTTCTCCGTAGTCCCACTGAAAATCCGTATTGCTGACCCACAACACGTGACG
ATAACGATAAGACAGCGTCCACGGAGACTATTTCCAGCTTCGCCCGTCTCTGTCCATTCACGCTGTAGACGCTCAGTCGG
CAACTTGCCCGCTCGGTGCCACTTCTGCAGCCTTTTTCTGCTCTTCTACGCATACGACAGCGACGACAGCGACGACAGTG
ACGACGCAGACGGAACGGACGACACGGACGATAAGAGAAGCAATCGACATTCTGCTCTCGCATTCCCCAGCACGCTCTTC
AGATCGGGGCCTTTCCCATCGGCTCTAACACGCAGTCTTGATGCCGAACCCAGACGATGTGGCCTCGCCGACGCAGTCGA
TCCAGTCGATCCAGTCGCTGCCGGCAGCGGCGACGGCGATGAGGCTGCCGAAGCACCGCCACGGCTCACTCGACAACGAT
CCGCCGACCGGAGCAGCGCACCAGATGCACCATCACCACCGTGCGCCACGGCCGATGCCGCTCTCGCATTCGGAGGCCAG
CCTTCCGATCCGGCGGCCAACACCGACGACAGCATCGCTGTATGCGTCGACGTTATCGCCGCCGGGATCGCGGTCGATGT
CACCGGTGGGCCGCGTCAGCTCGCCGGCAGCGCGACCGTCATCGATGGCGGCATCTATGCTGGGCAGTCTAGGCGGTGGG
GCCGGGCCCATCATCGGCATAGGGGGTGACGTGCGTGGCAGCCGGAGCAACAGCGTCAGCACGGTGAACACGGTGAGCAC
GGTGACGGGGGCGGCTCCGCCGATCGGGGCGCCGTTCTCGCGGTCTCTGCTGGAGAGTCCGGCGGCCGAGAGCGCGGGCG
AGCCGCTGTCGCTGCTGCTCAAGGCATTTGTGCCGCACGTGGCGGTGTACTCGTCGCGCGACACGGACGCGCTGCTGCGC
GAGAAGGGCTTCAGCCGTGGGCTGTGCGAGCTATTGCAGCCGTTTGGCGAGCAGGTGCAGGGCCGCGTGATGGTGCGCGA
CAGCAACGGGACGACGCGGCCGCGCGACGACTTTGCCGTGCGCTTCGTGCCGTTTGGCGACAACATCGAGACGCCGCAGC
CGGTGCACGGCGTAGTCAAGGCGTCGGTGACGGCGCCGTCGCTGCCGTTGTTTGGGGCCCTGCGGCGGGGCGGCAGTCTC
CGCGCATCAGCAGCAGACGGAGGAGGTGGTGATGCGGCCGAGACACCGGCAGCGGCAGCAAGAGCACGCATGAACAGCCG
GTCGGCCAGCAATGCGGCCGAGTCGCGAATCCCGCTGGTCGAGGCCGTGGTCGAGCAGCACCTCCGGTTCGCAGAACAGT
CCTTTCTGGGAGGGCTTCAACAGCCAACAACGTCCATGGCTAAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAACAACAA
CAACAGTCACAACAAACGCAGCAGTCACAACAACAACACGACCTGGAGCTCGACGCCGAGACCACGTCGCCCTACTACTC
GCTATACCTGCGGCGACTGCTCTCAGGGCTGCCGGTGGCGTGCCACGAGACGTTTGCACACCCGGTGGCTTGTGTGATCG
CGATCAGCTCGCGCAACTCGTCGCCAATCCAGACGTTCCAGGAGCTGTACCGCGACATCAGCCAGGGCGAGAGGCAGCTG
CCGCCGTGGGTGGACGGCGACTTTCTGCGGTACTACGTGCTCGTGCACGATGAAGAGCGCGGCGATATTGTGCAGTCGAT
GGCGCTGTTTGAGAAGATGAAGCGCAGCCTGGGGCTGCACTGCCATCTGCTACGGATCCGGAGTATACAGAGCGCAGAGA
CAGACGACGACAGCGTTCTGCTGCCGCGCAGCGACTGGATGACAGCAGCCGAGGAGTATGCCGACTTGGAGCGAAGCGAG
CGATGGGAGTGGGACCGGAAAGGCGAGAGGGAGGAGGCGGATGGGGGCGAGGGCGAGGGCAAGGGAGAATATGGCGAGTA
CGACGACGAGGACGACTACGCAAGCCCGACGCGATACATTTTCGAGTCAGACGCAGCAGCAGTCCGAACGTTTGTGCGCG
AGCTGGTGACGCAATCAATCATCCCGACGATGGAGCGCAGCGTTTCGGTGTGGAACGACCAGGTGGCATCGAAGCGACGG
GGACTAAGCGGACGGTTTATCAGCCTGTCGAAGCGATGGGCCGGTTTTGGCAGCAGCAGCAGCAGCAGCAGCAGCAACGG
GAACAGCGGCAGCGGCGGGTCACGACACGGAGCCAGCGGCAGCGGAGGAGGATCGAGCTACAACGGACAACAGGGATACT
ACGCAGCCGAGGCGTCAGAGGCGGTGATGCGGAAGCTGGCGGACTACGCCTTTATGCTGCGAGACTGGAAGTTGGCGATG
TCGACATACGACATTCTGCGGGCGGATTTTGCCAATGACAAGGCGTGGAAATACCACGCAGCCGCACACGAGATGTGCGG
GTTGGCGCTGCTGATCCTGGCGCCGGCAGCATCGTCGCGCACGAAGCTGGAGACGGTCGACAGCATGCTGGAGCAGGCGT
ACTACTCGTACCACACGCGCTGTGGCAACGCATACGGGGCGCTTCGGAGCGTAACCTTGGGGCTGGAGCTGCTGCGGCTG
CGCGGCGGTGCGGCAGCAGTAGGCGACGCCGTGCGCTGGGGCATGCGGCTGCTAGAGGCGCGACTGGCCGGCGCGGTGGG
TGATGCGCTGCTGCGGGAGCGCGTGGCGGCCTGCTGCAGTGCCCGGCCGGCCGTCGGGGCTGGACCGCTGACGGCCTGGG
GCAGCTGGCGGCGCAAGGCGGCCTTCTGGCACGTGCTGGCGGCCGAGACATGGGTGGCTCAGGGCAAGTACATCCAGGCA
CAGCGCTGTCTGAACGAGGCCCGGCGGGCGTACTCGCTGCTGCACTGTGACGACGGCATCGGCGGGTTCGCGCTCGCGAG
CGGGCTCATGACCGGACTGCAGAGGCGGCTGAAGCAGGGGCTGGCAGCCGGGGGAAGAGGGCCGGCCGGAGGTGCAGGAG
GCGGTGCAGAACCGACAGAGCCGGCAGAACAGTCGGGGACAGGCGCAGAAGCAGACGCGTCGACACCACAGGCAGACGAG
GAGGTGCAGTTGATGGCTGATGCACGGGCCGAGAAGATGGCTAAACGACGGTCACGTGCAAACAGCCTTTTGGGCGGCGG
TGGAGTCCAGTCGGCCTTGGAGACGGCCCCACTACGGAGTCTGGCCGTGGCGATAGAACAGGGAGATCCAGACCTGTTGG
ATGGAGGGTTTGGAAAGGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62