GenePrediction:GLEAN_2484 Details

Name: GLEAN_2484
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1404268..1405550 (+ strand)
Length: 1283
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1404268..1404364 (+ strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_140:1404523..1405550 (+ strand)
Length: 1028
>GLEAN_2484 class=GenePrediction position=GCSC_140:1404268..1405550 (+ strand)
ATGTCTTCCATCAAGATCGAACCCCTCGCTGTTGGCGGAAAGTCCAAGGTCAACTTTGGAGCCATTGTCACCAACGTGGA
TATCGAGAACCTGACGGGTAAGTGAGTCGAACTGCAACTGCAATGGCACGGCTGCACGCCGCATGCGACGTGCAACAACC
CACTTTGGGAGAATACCCGTGAAATCGGTAACCTCCCGGTAAGCTCTGCCACGACCCTCTGGTGAAGCCAGAAGACAGCA
GGCTGACGTGTGCAGACGTCGACTTTGAGGCGATCCGCGACGCCCTGTTCCGCAACCAAGTGCTCGTGTTCCCGAACCAG
AGCGACGTGTCGCCCCAGAAGCAGTTTGAGCTGACGCAGCGCTTCGATCCGACCGGCACGTCATACGGCCACGGCAAGAC
GTTGGATGCGAAGAAGTCGGTGCTGCACCCAGATCTCAAGACGATCCCACACCAGCCACAGGTGCAGGTGATCGGCAACG
GTTTTGTCGAGGCGTACGAGGGCCTGCAGAACGTGCAGCTGCGCCACCCGCACCACCGCACGTTTCATGCCACCGTGATC
CCGGACGCCGAAGACCTCGACTTCACCCGCTTCTACCGCTGGCACATCGACGCTGCTCTGTACGGACTGGCGCCGCCGGT
CGTCACGACGCTGCTGGCCGTGCGCGTGCCCGGCGGCCGTCGCCAGACCTGCCGCTACGACGACGGCTCCGGCGACGAGC
TCGACGTGCCGCTTGGCACCACCGCCTTTGCCTCAGGCGAGACCATGTACGACCTGCTCAACCCGGCCGATCAGCTGCTC
GCCCGCACTGCCCGCGTCGAGTACGCCGCCCACCCGTACATTTGGATGAGCGGGGCCAAGTCGCGCTCCGACGGCCTCGG
GCTCGTGTCGGAGGGCCGCGAGCTCACCCCCGCCGAATTGCCGCCCGTCGAGCAGGACAAGATCCAGATCCTGCCGCTCT
GCTGGCGCAACCCCGTCACTGGCCGTCTCGCCCTGCAGGTCCACCCCAGTGCCGTCCGTCGCCTGCATCTGGCTGACGGC
TCTGTCATCGACGACCTCGTCGAGGTCCGCGACATCATTCACCGCCTCCAGCGCCCCGGCATCGCCCCCGAGCTCATCTA
CCCACACGACTGGAAGGCCGGCGACCTCGTGCTGTTTCACAACCGCGGCCTCATCCACTCCGTCGTCGGCGCCTTTGCCC
CCGACGAGGTCCGCCTGTTCCGCCAGTGCAACATCGCCGCCAGCCATCTGCCCGAGGGACCGGCCGTCGAGGTGTCTGCA
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62