GenePrediction:GLEAN_2485 Details

Name: GLEAN_2485
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1405854..1406985 (+ strand)
Length: 1132
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1405854..1406172 (+ strand)
Length: 319
Type: CDS
Source: GLEAN
Position: GCSC_140:1406228..1406985 (+ strand)
Length: 758
>GLEAN_2485 class=GenePrediction position=GCSC_140:1405854..1406985 (+ strand)
ATGGCCAGCTACACGGCCGGACGGGTCCCTGCCTTTGTGTCCTTGGGGATGGTGGTGGTAGACGAGCTTCGCTCGCCTGG
AAAGACGCCACGAACAAACATTCCTGGAGGCTCTGGCACCTTTTCCACCTTTGGCGCCCGTCTTGTCAGCGGCAGGGACC
AGGCCGCAGATGTCGGCTGCTTCATCCTAGCCGGAAGTGACTTTCCGCAGTCTGTGTTGGACCGGCTGGAAGAATGGGAC
ATTGACCTGACTGTCAAAGTCGATCCTACCCGACTCTCGACCCGTGGCCTGCTCGAGTATCACGATGCCGCATTCAGCAG
TTAGTCCGTGGAAATGCAGCCACAGAACGGCCATCTAACCGATGTCGGCTCTAGGGAAGACCTTTCACTACACGACGACG
CCGCTCCAGCCCACGCCCAAGGACCTGCCGCTGCCGCTGCTGGCCGCCTCGTCCTTCCACCTACTGGCAGGTCCGGCCGA
CTTGGAGAGGCAGGTCGGAGAGCTGCTCCGGCTGCGGTCACAGTCACGTGATACATCAGAGAGACGTCCGCTGCTTGTGT
GGGAGCCGCTGCCGATCCAGGTCAGCGCGGCGGCCAGAGAGGCCCATCTGGCCGCCTGCAGGCTCGTGCATGTATTCTCG
CCCAACCATCTGGAGCTCATCATGCTCTTCCAGGGCCCCGTGTCGCCGGAAGAGGCCGACGATGCAGCCTTCCGGACGGA
CCTGGTCGAGGCGTACGCAGACGCCGTTCTCGACGCCGGCATCGGCCCCGATGGCAACGGCACCATTGTCGTTCGTGCTG
GCAGCCGCGGCTGTCTCGTGTCCTCGACTCAGATCCACGGCCGTCATCGCTGGCTGCCGGCCGTCTCGTTTGCCCACGGC
AGCCGGCGCGCCGTCGTAGATGCGACCGGCGCCGGAAATACGTTTCTCGGCGCGCTCACGTTCGCCATGGCCTCGCACGA
CCACGACGTCTTGGTGGCTGCCAGACAGGCCACCGTTGCTGCCAGCTTTGCCATTGAGCAGATCGGCCTGGCCACGCTCG
AGAGGCCGGCCGATGGACAAGAAGAAGAACGGTGGAATGGCCAGACGTTTGGCGAGCGTTTCAAGACACACGAGAGCATG
CAACTTCTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62