GenePrediction:GLEAN_2486 Details

Name: GLEAN_2486
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1409888..1413607 (+ strand)
Length: 3720
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1409888..1413607 (+ strand)
Length: 3720
>GLEAN_2486 class=GenePrediction position=GCSC_140:1409888..1413607 (+ strand)
ATGGCGGTGCAGAACTCGACAGGAGACGTCACTGCCGACGCAGACAGCGATTCGAGCAGCCAGAGCACGGTGTCGACCAT
ACAGCCATTTCCACAGCTGCGCAACAATGCGGCGACAGACGTGGACACGGACGTGAGCACGGCGTCTTCGCGGGCGGCGA
TGAAGACGCGCAGTCGGGTGGCAGACGCAGGCGAGGACAATGACGACGACGAGGATCCGGTTGTGGCGAAGCCATTTTTG
CGGACGCTGCGGGCGACGAGCGCAGACCACGGCGGCGTCAGGGGCTCAGGGTGTTCGGACAGCAGTCTGGACGAGGAAGA
GGACGATGAGGTGGCCAACAGCGGAGGAGGAGGCGGCGGGGGACCGCACGCAGCGCAAGCAGGATCAGGCGGCCAAGGTG
GCGGAGCCGAAGGGCGAGAGCGACGGACGGCAATTGCACAGGAACGGCTAGGCCACAAGATGCACAAGTTCACGCTGTAC
GAGACGGCAAGCCGTTACTACATTGTGGGAGAGGACGTGACGGGACGACGGTACCGGGTGCTGAAGATTGACCGGACGAC
GTCGAGCAAGGATGGGCTGAGCCTCACGGACGACCGGATCGTGTACAGCCAGAAGGAGATGATCCAGCTGCTGGACACGA
TTGACGACGGGAACCGGTTGACGGGCGGGATCAAGGTGCGGTGCACGATGTGGGGACTGCTGGGGTTCATCCGGTTTACG
GGGCCGTACTACATGATGCTGATCACGAAGAAGTCGACGGTGGCGGTGATCGGGGGCCACACGATCTACCAGATCACGGG
GACAGAACTGGTGCCGCTGACGCCGGGACGGGGGGCCGGACGGGCGTTGGAGCACGTGTCGAGCAGTACTGGGGAGAGTG
GAGGGGGGGGTGATGGGAGCAGCAACGGCAACGCGAGTGGAAACAACAACGGCAACACGACGACAAACGCAGCAAACAGC
AGCACGACGACCAACAGCAACACAGCCCACCACCACAGCGGACCCAGCGTCAGCAGTGCGGACGAGGCGCGGTTCCTGAC
GATCTTTAACCAGGTGAACCTGGCGCAGTCGTTCTACTTCAGCTACTCGTACGACCTCACGCACACGCTGCAGCACAACA
TCAGCAAGGAGCGGACGGCACTGGCGTCGGGGCGACGATGGCCGTGCGACGAGGACCACAACTCGATGTTTGTATGGAAC
ACGCACCTGCTGCAGGCAGCACGGGCAGCACTGGCGGCGCCGTTCGACTGGTGCCGGCCAATCACACACGGCTACATGGA
CCAGGCGTCGATCTCGATCTACGGGCGGACGGCGTACGTGGCGATCATCGCGCGACGATCGCGACACTTTGCAGGAGCGC
GGTTTCTCAAGCGGGGCGCCAACGACCTCGGATACGTGGCCAACGACGTGGAGACGGAACAGATCGTGTCGGAGGCCAGC
ACGACGTCATTCCACTCACCGGGACGGCGGCTGTTTGCCAATGCGCAGTACACGTCGTACGTGCAGCACCGCGGCAGCAT
TCCGCTGTACTGGACGCAGGAGAACACGGGGGTGACGCCGAAGCCGCCGATCGAGCTGAACCTGGTGGACCCGTTCTACA
GCGCGGCGGCGCTGCACTTTGACGACCTGTTTGCGCGGTACGGCGCGCCGATCTACGTGCTGGACCTGGTGAAGGCGCGC
GAGAGCACGCCGCGGGAGTCGAAGCTGCTGGAGGAGTTTCAGCGGGCAACGCGGTACCTAAACCAGTTTCTGCCGGCGGA
TCGGCAGATTGTGCACCACGCGTGGGACATGTCGCGAGCAAACAAGAGCCGGGACGTGAACGTGATCGAGGTACTGGAGG
CGATTGCCGAGCGAGTAGTGGCGACGACAGGATTTTTCCGGAACGGCGAGGGCGATGGCAGCGGAAACGGAAGCTCTGGA
TCAGAAACGCCAGCACGAGTACAAAACGGGGTGGCACGGACAAACTGCATCGACTGTCTGGACCGGACGAACGCGGCGCA
GTTCGTGATTGGCAAGTGCGCGCTGGGTCACCAGCTGCACGCGCTCGGAATCCTGGACGAGCCGACAGTCCGATGGGAGA
CGGATGCGGTCAACCTGTTCACGCACATGTACCACGACCACGGCGACACGATCGCGGTGCAGTACGGCGGCTCGCAGCTG
GTGAACACGATGGAGACGTACCGCAAGATTAACCAGTGGCAGAGCCACTCGCGCGACATGCTCGAGTCCTTCAAGCGCTA
CTACAACAACTCCTTTCTGGACGGCCAGCGCCAGGAGGCCTACAATCTGTTCCTCGGCAACTACGTCTATGCGCCGGGGC
AGCCGATGCTCTGGGACCTGCCGACCGACTACCACCTGCACCACGCGGACCCGCGTCGTTGTCTGGAACAGCAGCATCGC
CGCGACTACGTCCACTGGTTCACGCCCGAGAACCTGCGCCGTCGGCTGCTGCCGCCGTTGCCGGCCGAACGACCGGCCGA
TCCGAGTGGTGGTGGTGGCGGGGGCTCGTCTGGGCTGACACGTGGCGGTCGTCGGGTCAACAGCCGGCACGGGCTGATCG
CCAGCAAGCCACTGTCGTATTTTGACGACTACTGGCTCGAGTTTTACCGGCCCTTCTTCCTGTCGTCCTTTTCCAAGATG
TTCACCTTTCGGATCAAGTCGACGATGAAATACATTCCTCCGGGCCCAGCCCACCACGGCCAGTACGATCTGAGTCCGTT
CAAGGTGCGCAGCGACACAGGAGGAGGAGGTGGTGGTGGAGGAGGGGGAGCGGTTTATATTGGAGGCAATGGAGGCGATG
TGGATGCAGCAACAGCAGCAGCAACAGCAGCAACGGAAAAGAAACGAAGCCGACATCGGAAGGAGGTGTCGTTTGCATCG
ACGGACGATGTAGCGAGTGTGCGGTCAACAGGAACAGCAGCAGCAGCAGCAACAGCAACAACAACAACAACAACAACAAC
AGCGAAATCAGATCGGAACTCAGACACAGCGTCACTGCAGGGAATCATGCGGGAGGGCGGTGCGGGGACGAGCAGTCCGG
GATCGGGGACGATGGCGACGAGCACAGCAGCAGCGACGACGGCGACGACGACAGCGACGATCATGTCGTCGCAGGGTCCT
GGACGGCGTTTGGCAGGAGAAGGAGGAGGAGGAGGAGGAAGACAGGGTAGCAGCCTTGACACGACAACGGTGATGATGGG
TGGTGACAGCGGCGGGCTATCGCTCTCTGAGTTGGACGCGCGACGACGCCAGAAGAAGCAGTCGACGCTGGAGAAGACGC
GACGAGCCCAATGGACGCTGGCCAAGATGGTCGAGGGCTCGCTGAACCCATCGGTGCAGGAGACAGACGACTATGAACGC
TACATCAGCCACCTGCAGAACCTGCGGCTGGTCGTGCCGGACAAGGCGGAGGGCGGCGGCGTCGTCGAGGTGGCCGACGA
CCGCATCGTCAGCAACAACGACGAGTACGACGAGTATGTTGACGGGAGCTGGAAGACGGACGGACTCGGACTTGGACTCG
GACTTGGGCTCCGATTCGGGGGGTCCGACGGGTCCGACGACGAGACGGCCCTATACGGCGAGTTGCTGCGGGTGTCGGAC
AGTCCGCTGACGGTGACCGAGGGTGACGCCCAGAAGAAGCGCTACAAGGCATACCGGAAGTGGCTGCAGGGCAAGTCGTT
TTTCAAGCAGCAGCCCGTCGACGGCTGGCTGATGAGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62