GenePrediction:GLEAN_2487 Details

Name: GLEAN_2487
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1419355..1421501 (+ strand)
Length: 2147
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1419355..1419476 (+ strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_140:1419580..1420256 (+ strand)
Length: 677
Type: CDS
Source: GLEAN
Position: GCSC_140:1420333..1420652 (+ strand)
Length: 320
Type: CDS
Source: GLEAN
Position: GCSC_140:1420717..1420812 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_140:1420869..1421000 (+ strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_140:1421412..1421501 (+ strand)
Length: 90
>GLEAN_2487 class=GenePrediction position=GCSC_140:1419355..1421501 (+ strand)
ATGAGTGACATGCTGCCCTACGCATCTTCCGGGTCGAAGGTGACCCCAAGACACAATGCGAACGTAGGATACTCCAATGG
ATATCCGCGAAACTCCAGCACCTTGGAGTTCTCGCCACACCGGTACGGCAGGCTTCCTGGACAGCTTTCTCCCTTTGACC
TTGTCCCTGTCATCAGCCGGTCTGCGCACACTCTTCTGACCTCGTCTTGCTTGCCGGCTCTATAGATTTCAGCCCCGGGG
CTCTCCGCCGTCTCTGCGTCGACGAAGAAAGCTGCTCGTGCGGCTCGCCATCCTCTCCGTGATCGTGCTTTTTGGCGTCT
TTGTGTGGCCGGGCGCACCCGTTCTATCGGTCTTCTCGCTCAGCCTATTCGCCGGCAGCGAGGGAATCCAGCTCGAAACC
GTGCGGTACTATGACCTTTCTAACGTCCAGGGCACTGCGCGCGGTTGGGAGCGCGAGGAACGTATCCTGCTGTGTGTTCC
GCTGCGTGACGCCGCACCGCATCTGCCAATGTTCTTCTCTCATCTGCGCAATTTCACATATCCCCACCACCTTATCGATC
TAGCCTTCCTCGTGTCCGATTCCAAGGATCGCACCCTCGACCTTCTGATCGAGAACCTTGAGTCCATCCAGGCAGACAAC
GACTCAGAGGAACATTTCGGCGAGATCTCCATCCTCGAGAAGGACTTTGGCCAGAAGGTCAACCAGGATGTTGAAAGCCG
TCACGGCTTTGCCGCACAGGCCAACCGTCGCAAACTTATGGCACAGGCCCGGAACTGGCTGCTGAGTGCCTCCCTCCGGC
CGTACCATTCCTGGGTCTACTGGCGTGATGTTGATGTCGAGACTGCGCCGTTCACTATTCTCGAAGACCTGATGCGCCAC
AACAAGGATGTCATTGTACCGAGTACGTTCTCCTCACTGTGTTGCAACCGTCCGACATGTCCAATCTCATTGTACGTACA
CAAGACTAATCGTTCTAGATGTTTGGCGGCCACTTCCCGATTGGCTAGGCGGCGAACAGCCGTACGATCTTAACTCGTGG
CAGGAGTCCGAAACGGCTCTGGCCCTGGCCGACACACTGGACGAGGACGCCGTCATTGTCGAGGGCTACGCTGAGTACGC
AACTTGGCGGCCGCATCTGGCTTACCTTCGCGACCCCTACGGTGACCCGGACATGGAAATGGAGATCGACGGTGTCGGTG
GCGTCAGCATTCTGGCCAAGGCCATGGTGTTCAGAACTGGTGTGCATTTCCCGGCGTTCAGCTTTGAGAAGCATGCGGAA
ACCGAAGGCTTCGGCAAGGTGAGTTCTTGGAGGTGGCGGTGAACGTCTGATAGTCGGTGTTTCTCACTATTCTCAATCGC
AGATGGCAAAACGCATGGGCTACTCCGTCGTTGGTCTCCCGCACTACACCATCTGGCACTTGTACGAGCCAAGTCTGGAT
GACATCCGGCACATGGAGGTAAGCTTTACCGATACACACCATCTTACAAACGCACTTTATGCTGACCATGTTAGGAAATG
GAGAACGAAAGGATTGCCCGGGAGAACGAAGAGAAGGAGAAGGCCGAGAAGGCAGAAAAGATGAAGAACACCTTTGGCGA
TCCAAATGGCCAGTGGGAGAAGGACAAGGCTGCTATGCAGGACATTGTCATTGAAGATAAGCCAGCTCTGGCCGAGGTCG
TTGCCGAGATTCCTGCGGCCGCAGCTGCTGCTGCTGCTGCCGCTCCGGCTGCTGCTGAGGCCGTTGCTGGCGCTGGTGCT
GCTGTTCCTGCTGCACCAGCTGCTGCTCCCCCTGCTGCCCCTGCTGCCCCTGCTGCCCCTGCTGCCCCTGCTGCTGCTGC
TCCTGTTGCCGCTGCTCCGGTGGCTGCTGCTCCGGTGGCTGCTGCTCCTGTGGCTGCTGCTCCAGTTGCGGCGGCCCCTG
TTGCGGCAGCCCCTGTTGTCGCTGGCGGTATCCCAGCTGCCGAAGCCGTCGTTGGGGCTGTTGGGGCTATCGGGGCTGCA
GGTGCTGCAGGTGCTGCCGCTGTGGATGGCATCCCAGCAGGCGGCGTGGCTGCGCAGCCACACAATATCGCAGCCGAGAA
AGTTGCAGCCGAGAAGGCCGCCAATGCAGATGCGGCGGCCAAGGCTGCCAAGAATGTTGCGCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62