GenePrediction:GLEAN_2488 Details

Name: GLEAN_2488
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1422653..1427875 (+ strand)
Length: 5223
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1422653..1423199 (+ strand)
Length: 547
Type: CDS
Source: GLEAN
Position: GCSC_140:1423270..1426201 (+ strand)
Length: 2932
Type: CDS
Source: GLEAN
Position: GCSC_140:1426255..1426600 (+ strand)
Length: 346
Type: CDS
Source: GLEAN
Position: GCSC_140:1426654..1427152 (+ strand)
Length: 499
Type: CDS
Source: GLEAN
Position: GCSC_140:1427205..1427875 (+ strand)
Length: 671
>GLEAN_2488 class=GenePrediction position=GCSC_140:1422653..1427875 (+ strand)
ATGAGTGGCGATGCACGGGATGCTCCAGTGGCGGCTCTGGCTGCAGATGCCTCGGCCAAAGACCAGCAGCAGGAGCAGCT
TCCGCTGACCGCCCTCCTTGCTTCACCCACGGCGTCGCGCCCGTTTTCACAGCACCGCCAGTCGACAGCGGCGTCGTCGC
GGATGCAGTACCGCAGCCACCCCGTGTCGGTGGCCGTGGACCCTGTCTCGCTCGTGATATCCGAGTGCATCAACATCACG
TCGGCGATCCAGAAGCAGGCGCACTTCCAGCATCTATCGGTGTCGGCCATCCTCGGTGGTGGCTCGCCGAATGTGGGCAC
GAGCTCGTTCAAGCTCGGGGCTTCGGCCGAGACGTCAGTCCGGCGCAATGGCCATCGCACAGCGCCATCTCCGGGAGCCA
AGCGGGGGGCAGCCGGAAGTGGTCCGGACGTTGATTTCGGCCCGGCCAACCGTTGGGGCCTGCGTGGGAAGAAGGGGAAG
AGCATGGCGGACAACCCGCTGATCTCTGGCTTCGGTCGGCTACGACAGGAGCTGGCAGGCGTCAAAGGTAGGAAGCTCCA
ACTCAGCGGTACGAAGTAGTATGAAGTCGCTGTTTCTAACACAAATGGCCAAACCAGATATACACAGCTTCGATTCGCTC
ATGCTCCTGTACCCATTCCTGCAAATCATCCAGGCAAAGGGTACCGCGGCACCCATCACGATCCTCTCGCTGCGGGCGGT
CCGGAAGTTCCTCTCGTACGGATTCATATGTCAAGAGTCGCCTCGGTTTGCCTTGGCCATGCAAGCACTGTCACAGGCCA
TCACGCACTGCCAGTTCGACATTAGTGACAGCGCGCAGGAAGAGGTGGTGCTGTTGATGATACTCAACCTGATGGAGGAC
ATGCTGTCAGGGCCAGGTGGCGATATTCTGAGCGACGAGAGCGTCTGCGACATGATGGGCCGTGGCCTGACGATCTGCTC
GCGACCGCGCTTTTCTGAGGTGCTCCGGCAGACGGCCGAGGCGACGATGGTGCGGATGTGCCAGATCATCTTTGAGGACC
TGAAGCACCTGGAAGAAGAGGCTGGCGAGGAGGATGACGCGCTGGACAAGCAGACCGACGCGGACATGGACACGGTCAAG
ATGGATCCGGCTGCCGATGCGAGCGCGTCTTCGCTGTCGTTGCGGCCTGCTGTTGCAGCTGCTCTCCCGACAGCACATGG
CGGCAACGACAGCAGAAGCAGCAACGATGTCGGCTCGTCAGCTTCGTCTGGAGACAGCAAGGACAAGCTGCTCGTGGCCA
ATGCACCCAGTGGAGACATTGGACAGGGGCGGCTGTCCAGCGAGACACAGAGCGACGACGCGGACGAGAAGAGCACAGCG
TCGGGTTCGTCTGAGAGCTCCGAGTCGATAGACCTGCGGCCATATTCGCTGCCGTCGGTGCGGGAGCTGTTCCGCGTGCT
TGTGGACTTTCTGGACCCGAACCAACGCACGCAGCAGCCGGACACGATGCGGGTGATGGCTTTGCGGATCATCCACGTGG
CGCTGGAGGTTGCAGGGCCGTCGATCGCGCGGCATCCGGCGCTAGCAGCAGTGGCACAGGACCGGCTCTGCTGCTACCTC
TTCCAGCTGGTGCGGTCGGACAACATGGCGATCCTGCAGGAGTCGCTGATCGTGGCATCGACGCTGCTATCGACGTGCCG
CGGGGTGTTGAAGCTGCAGCAGGAGCTGTACCTGGCCTACGTGATCGGCTGCCTGCATCCGGCAGTGGAAATTCCGCGGG
AAGCCAACATCGACCCGTCGTTGTACGAGGGCATTCCACAGGCACCAAAGCTGGTCAAGGCACCACCACCGTCGCAGCCG
GGCAGCAGACAGCCAACACCAGTGCCGATCAAGGACCGGCAGAAGCTGGGAATGGAGGGCGGGACGCGCAAGCCGGAGGC
ACGACAGGCGATGGTGGAGAACATCGGCGTGCTGGCGCGGATGCCGACGTTCATGGTGGAGCTGTTTGTCAACTACGACT
GTGACACGGATCGGGTGGACCTGTGCGAGGACCTGATCGGGCTGCTGTCGCGAAACGCGCTGCCAGACTCGGCGACATGG
AGCACGACGAGCGTGCCACCACTCTGCCTGGACGCGCTGCTACGCTACATCCAGTTCATGGCACAGCGGCTGGACGAGCC
GGCCGTCACGGACGGCTACCCAGACGCAGGTGAGCTGCGGGAGGCACGGGCGCGCAAGAAGGTGATCGTGCGGGGCGCCA
ACAAGTTCAACGAGAGTCCCAAGGGCGGGCTGGCGTATCTGCACGACAAGGGCATCATCGCAGACCTGGGCGACCCGGTG
CTGGTGGCACGGTTCCTCAAGGGCACGTCGCGGGTGTCGAAGAAGGTGCTGGGTGACTACCTGTCGAAGCGCGGCAACGA
GCCGGTGCTGGAGGCGTTTATGGCGCTGTTCGACTTTGAGGGCAAGCGGGTGGACGAGTCGCTGCGGATGATGCTTGAGA
CGTTCCGGCTGCCGGGCGAGGCGGCGCTTATCGAGAGGATCGTCAGCTCATTTGCGGAGCGGTACTGCTCGGGGACGATT
CCGGCCGATGTGGCCGACAAGGACGCAGTCTTCATCCTGACGTATGCCATCATTCTGCTGAACACGGACCAGCACAACCC
GAACGTGCGGACGCAGAAACGGATGACGGTGACGGACTTCTCGCGCAACCTGCGGGGACAGAATGGGCGGCAGGACTTTG
CGGCCGAGTATCTGCAGGACATCTACGACTCGATCAAGTCGAACGAGATCATCCTTCCGGAGGAGCACGAGAACAAGCAC
GCGTTCGACTATGCGTGGCGCGAGGTGCTGCTCAAGGCCGGCTCAGCCGGGCCGCTGATTGTGTGTGACACCAACATCTA
CGACGCTGACATGTTTGCGACGACGTGGCGGCCGATTGTGGCGACGCTGTCGTACGTCTTCATGTCGGCCACAGATGACA
CCGTCTTCAGCCGAGTCATCCAGGGCTTCGACGAGTGCTCGCGCATTGCGTCGCGCCACGGCAACACGGCCGCGCTGGAC
CAGATTGTCTACTGCCTCAGCCTGATGAGCACGCTCGCCCAGGAGGTGCAGCTTAACACGAGCCTCAACACAGAGGTGCA
GGTTGATGATGCGAGCGTCATGGTCAGCGAGCTGGCCGTCAAGTTGGGCCGCAACTTCCGCGCCCAGCTATCGACACTGG
TGCTCTTCCGCGTCGTGCGTGACAACGAGCCGGTGTTGCGGATGAGCTGGAAGCACGTCGTGCGCATCTGGCTCAACCTG
TTCCAGAATTCGCTCATTCCCGCCTTCTTTTCGAGCGAGCAGCCCGGCCGGCTCGACCTGCCGTCCATTCCGCTGCAGAG
CCCCGGCCAGGTGATCGACCGCGGCAACAAGCAGGTCGACAACGGCTTCTTCTCGGCCTTTACGTCGTACATTTCCAGCT
ACGCGGCCGACGACCCGCCCGAGCCGTCGGACGAGGAGCTCGAGAGCACGCTGTGCGCCATTGACTGCGTGAATGCGTGT
CACGTGGGCGACATTTTCGCCAACATAGCGTGAGTTCTGTGCCCCACTGTCTTTGTAAGCCTCCACTGCTAACACGCCCC
AGCAACCTCTCGGGCGACAGCCTCGAGGCCCTGGTGGACGCGCTGCTGGATCAGATTCCGGAAGATAACGGCTCGGAGGT
GGTGATCAAGGTCAAGGCCGAGAACGTGCCGCCGACATCGCCGGCGAACAACATCAAGACAGGCAGCACGCCGGCCTACG
ATCCGGCACCGGTCTACCTGCTGGAGCTTTGCACTGTACTGGCGCTTCGGGACGCAGACTCAGTCCAGCTGGTGGGCAAG
CGCGTCGTGGATGCGCTTCAGGAGATGCTCCGCGATGTCGCCCGCTTTCATCCCATCCTGATCGGCCGGGCCACCTACTA
TCTCTTCACCCTACTACGGGCAAGCTATGTAAGTGTGCGAGTCAGACGAGGACAGAAGCAGAACGTTTGCTGACTGGACA
GGACTATGACTTTGTGCGCGTGCCGGTGCTTCTGCACGCCGTGTCGAGCTTCTCCGAGGAGAACCTCAAGGCCACGTCGG
CGGTCGTGCTCAAGGGCCTGAAGCTCAACATCTCCGAGCCCGGGCCATTGCGCAGCGAGATCATGACGTCGCCCGACTTT
TGGGCCATTCTCGGGACGCTCGTCGGCTACGAGGATTCCGCGCCTACCGTGTTTGAGATTCTCGAGAGCGGCGTCAGCGG
CTCGCCGCCGGCCATCCTGGCCGACAACTACGAGGCAGCTATCATCCTGTGCAACAAGTTTGCCACGGCAGCCAGCGTGG
GGGCTGCGGCTGAACAGGAGCTGGACCGGAAGCTGCGGCGGAACAACCGGGCACCCAAGCCGGAGAAGGCCAGCGAGAAC
GCGACGGTGCAACGAGGCATCAAGACCATCAACATCATCTACAACATCACGTCACGCATTCCCCATCTGATGAAGCAGTC
GCATCTAGAGAGCAATGAGGGTGAGATTTCCTTGATCTTGTTTAGTTCTTTCGCTCTTCTAACCCATCACAGCCTGGTCG
GCCTACTGGCTTCCCATCTTCCAGGCCCTCACTACGCAATGCACAAACCCGTGCCGCGAGGTGCGCCACCTGGCCTTCTC
GTCGCTGCAGCGCTCGCTGCTCTCGCCAGAGCTGACGTCGAGCGACCACCGCGAGTGGACGGCCATCTTTAGCGAGGTGC
TGTTCCCGTTAATCCTCAAGCTGCTGCGGCCCGAGGTGTACACGTCTGACCGTGACGGCATGAGCGAGACGCGCGTACAG
GCAGCGTCGCTGCTGTGCAAAGTCTTCCTGCAGTATCTCGTGCTGCTGTCGGATTGGGATGGCATGCTGGACCTGTGGCT
CAAGATTATCGATATCATGGACCGGCTGATGAACAGCGGCCAGGGCGACAGCCTGGAAGAGGCTGTACCTGAGAACCTCA
AGAACGTGCTGCTGTTCATGGCCAGCAGCGGCTATCTGGTTCCTCCGAGCAAGGACGCATCCAAAGAGGAGCTCTGGGTG
GAGACGTGGAAGCGCATCGACCGCTTCCTGCCCGACCTGAAGAGCGAAATTGCGCTGGACGAGCCGGAACAAACAACGCC
TGCGGTAAAGCCGAGCGATGTGGCCGAGGCGCCGACAGACGAAGAGCCTGTAGTAGAGGCAGAGGCAGAGCCTGCAGTAG
AAGGAACGGAAGTATTATCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62