GenePrediction:GLEAN_2491 Details

Name: GLEAN_2491
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1443515..1444830 (+ strand)
Length: 1316
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1443515..1443545 (+ strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_140:1443608..1444830 (+ strand)
Length: 1223
>GLEAN_2491 class=GenePrediction position=GCSC_140:1443515..1444830 (+ strand)
ATGTCACGGGAGACGGTAAAGACGGTACCGCGTATGTATATGCCAGCAGCGTCGCGTCTCTGGCGAGCTTCTTCCTGCTG
ACCGCGCCAAAAGCATGGGTCATTCGCCGACCTCCACAGACTGTATACCCGCAACGCAACCATGACCCCTCTGAGGCGCG
GTACAATCAAGGACCCTCTGGCGGTTCGGTGCCTAACGGCAAGGGCCAAGAGCATGCTGGCGAAAACGGCACCTCTGAGG
GATTGAATAAGCCCGCGCCAAAACCTGCCGGAACGACAGCACCGTCCCCAATACCAAAGCCTCCTGCCCCGACGCCTGCG
GCTGCCCCTAGTCTGAGATATCGCCTATCGCTCTTGTTCCGACCAAAGGAGGGCCGGAAATGGGACCATCTGCGCTCGGC
TGAACCTGTCATCGTGCCACAGTACCACGTAACCAAGGGGCCGACAACATACAGGACAGAATGGGACAGACACACACCTA
GGAGGCCGGGCGCACCGGGCGCGCCGAGTGGAAGCAGTGCACAAGCAGGGGCCAGCTCATCGGCCTCTGGTCATCCGGAC
GCGTCTGCGGCCACGGCGAGAACACCGTGGTGGTACAACCCCGAGTCGCAGTGGCACGCCTTTATCGAGTCCACGCGCTA
CCCGCACGCGGCAAACGAGAAGTCCGAGATACTGGACGACGAAGAGATGCAGCGGCTTAATCTCATGGACTTTGGCTATC
TCTCGTCGCTGCATCCCAAAGTCGGCGGTGGCGATGGCGGCGGCGGTGTTGGCCAATTTCACCATAAGCTTCACGTCCCC
AGCAAGCTGGCCGACAAGCCGGTATGGCAGCGCATCTGGGAGCTGCTGCTTCACCACCCGCTGGTGCCGCTTGCCTGCCG
CCTGACCGTGCTCATGACCTCGATTGTGGCTCTGGCGGTGGCCATCGAGATTCATAAACGGGAGCGGCTCAACACGGTGG
GGAAGGCTGGCAGCTTGGGCAACGCGCCAGAGCGGACGCAGGTGATCGTGGCTATTGTTGTTGATGTGGTGGCGGTGCCG
TACATTGGCTATATCACCGTGGACGACTATACGGGCAAGCCGTTGGGTCTGCGCCCGCCGGCGGATCGCATTCGGCTCAT
CTTGACGGACCTGTTCTTCATCATATTCAAGTCGGCAAGCACGTCGCTCGGGTTCGAGGCCATGATCTTTGTGTCCTCCG
AAGGCAGCGAGGGCCTTCTGCGGACGTTGGGGGCCTTTGAGCTCATCGGGCTGGTGTCGTGGGCTCTCACGCTGACGATT
AACATCTTCCGAGTAATAGAGCGGCTCGGGGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62