GenePrediction:GLEAN_2492 Details

Name: GLEAN_2492
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1445487..1452248 (+ strand)
Length: 6762
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1445487..1446704 (+ strand)
Length: 1218
Type: CDS
Source: GLEAN
Position: GCSC_140:1446901..1446953 (+ strand)
Length: 53
Type: CDS
Source: GLEAN
Position: GCSC_140:1447133..1451920 (+ strand)
Length: 4788
Type: CDS
Source: GLEAN
Position: GCSC_140:1451981..1452248 (+ strand)
Length: 268
>GLEAN_2492 class=GenePrediction position=GCSC_140:1445487..1452248 (+ strand)
ATGGAGGCGCCAATGAGCACACAAGAGCAGCAGCTCTGCGAGTTCCTGATGGGTCTCGCAGCCAAGTATTCATGCCGTTA
CAACGAGCAGGCCGAGCGGGATCTCCTGCAAAGCCTCTTCTGGTGCATGGCCGGTGGAAATGCGCAGTACATGGACCGAT
TCTTTCCCATAACCGGTGGGCCACTACGGGGAGGTACGCTGAAGCTTCGGGAAGCACAAGGCGCGGTGAACGGGGCGGAA
TACACAGAGGCCGCACGGGGTCACGCGTGTGGCCATATATTTCGGCCTGGCGAGGCTACCTATTCGTGCAAGACGTGCGG
GACAGATGATACGTGTTGTCTCTGCAGCCGCTGCTTCGAATCCACAGACCATCGAGGCCATATGGTGCGCATCAGCGTGT
CGCCCGGTAACAGCGGCTGCTGCGACTGCGGCGACTCAGAGGCCTGGAGGACGCCAATGTACTGCACCATACACTCGGCC
TGGCAGGACGGCTTCGGGGGCAAGAACAAGGGCAAAGCGCCGGTCGGGACGCCACGCGACCTGGAGGAAAGCATCCGCAT
GACCATCAGCCGGGTTTTCGACTTTATGTGCGACGTGGTGTCGTGTTCGCCCGAGCAGCTGCGCCAGACCAAGACGGTCC
AGTCGATCCAGCACGACGAGCGCATGTCCCGGCTGTCGGCGACGTACGGTGGCGGTGACACTGGCCCCCCTGACGAATAC
GCGGTGCTTCTCTGGAACGACGAGAAGCACACGGTCACGGACGTGGCACACCAGGTGGCGAGGGCATGTCAGACGACCGC
AGCGGACGGCCAGAAGCGGGCCCACGAGACGGACGAGATTGGGCGAAGCCTACTGAAGCACTCGCAAAGCATCGAGAGCC
TGCTCCGGGTGTCACGGATACTCGAGGACATCAAGGTGACGGTGACGATCCGGTCGTCCCGGGACACGTTCCGGGAGCAG
ATGTGTGGGAGCATAATCGAGTGGCTGTCAGATATAACCGGCTGCAGTGTCGGCGACGACCACGGCATCCTTCGGCGAGT
GGTATGCGAGGAGCTTCTGCGGCCGTGGCGCAAGGGCAGTCCGGCCAGCCATGCGATTGTGGGGCAAAACGGCATAGACG
ACGAGGACACATTGTCACAGGATGGAGAAGCTGTGAACCCGGTGTTCGCCCATGAAATGCTGCTGCGGAATAGGCGGGCT
GCGCAGATGGCGGCCATGGTAGAGGACAGCGGCGAGGATGAGGAGGACGATGACGAGGAGGACGAAGACATTGATATCAT
CATTGCCGAAGGAGAGGATGACGACGATGAGGACAACGACGAGGAAGATGGCGAGGAAGCAGCAGCGACAGGCGACGACC
AGGCAGAGGATGCTGGTGACGGCGACGTAATCATGTCTGACGCACAGCCAGCAGATGCAGTTCCGGGCGACGCCACGACA
GCAGCCACACGAGAACCGGACGGCCGTGTGCGCACGAACCCGTGGCAGGTGATGCCGTTTGAGATTGCCGAGATGGACGA
AGCTCTTCTGGCTGGCTACCAGATGCCAACTCCAGCAACAGCAGCAGCAGCTACAGCGGCAGGACCTGCGGCAGCCACGC
CAGCCATTATTGCGCCTGTACCTGTGGCTGCCCCCCTCTCGGCAAGACGCAACATCCGGGAACGCGATGTGACGCCGTCG
GATTCGGACACGGCCGAGCCGCTGATAGCAGCGAGCACGTATGCCAAGATCGGGCTCGACATCCCCAAGACACCTGGCGG
CGGGGTGACGGAGAAGGCACCGCCTCCCAAGCCGGGACACTACTGGCTCGGGGTGCCGGCGGCATACATGGAGTGTGAGG
GGGTGCAGCCGGCCGAGGACCTCTTCCAGCGGGTGCGGCTCGACTGGCTGATCCTGTTCGATCTGCGGATGTGGAAGAAG
GTGCGCAACGACCTGCGGTCGCTCTACATATCGACGGTGGTGACGATCCCGGAATTCAAACGGGTGCTCGGGCTGCGCTT
CGCCGGGCTGTACACGACGCTCGCACAGCTGTACCTCATCGGCGACCGCGAACCGGACCACTCGATCATCAACATCTCGC
TGCAGATGCTGACAACGCCGTCGATCACGGCGGAGATCGTGGAGCGCGGCAACTTCCTGACCAGCCTGATGGCGATCCTG
TACACGTTCCTGACGACGCGGCAGGTGGGCCATCCGTGGGACGTGTCGTCGAGCGCGGTGCTGGCATTTGACTCGGGCTC
GGTGACGAACCGGCGGATGTACCACTTCTTCGTGGACCTTAAGTTCCTCTTCAGCTCGCCACACGTGCAGGAGCGTCTGC
GGACGGAGGACCGGTACATGATGCAATTCCTGGACCTGGTCAAGCTGCACCAGGGCATTTGTCCGAACACGCGGGCGATC
GGCGAGCACGTGGAGTACGAGACGGACACGTGGATCAGCGCGTCGCTGATCACGCGCGAGATCAACCGACTGTGCCGGCA
GTTTTCGGAGGCGTTCCGCAACCTGCGCTCGGCAGACTACGTGCACCTACACCGGGCGATTCGGGTTGCGACCAAGAGCG
TGATCATCAACTCGATCGGGGCAGAGCGGCTGCGATTCTCGCAGGCGGAGATCCGCGACGAGGTGGTGTTCAAGACGGTA
ACGGATCTGGAGTTTGACGAGGTGGACGCGCGGTACGACGTGGTGGCATTCGTGGTGGAGCGACAGCCGATCAGCTTCCA
CCACGCGCTGCACTACACGCTCTCGTGGCTGATCGAGTGCGGGCGGTCGATGTCGGTGGAGACGCTGCGGGCGCTGCTCA
GCTTCACGGCGGCCGAGCTGAAGGGCACGCCACGGTCGATGGGCCGCAAGATTATGCCGCGGCGCGACTACGAGGCAGAA
GACTACCTGATGGCAGCGTTTGACTACTCGCTGCGGGTGTGCGCGTGGCTGGCGCAGATGAAGGCGGGCATGTGGGTGCG
CAACGGGATCAGCCTGCGGCACCAAGCGGGGACGTACCGGGGGGTGAGCCAGCGTGACGTGGCGCACCACCGAGACGTGT
TCCTGCTGCAGACGGCGCTGGTGGTGTGCAACCCGAGCCGAGTGCTGGCGTCGGTGATCGACCGGTTCGGGATGGAGCGG
TGGGTCAAGGGCATCTTTGAGCAAAAGACGGAGGCACAGGACGACGGGCAGCACCTGGACGTGGTGGAGGACATGGTGCA
CCTGCTGATCGTGCTGGTGAGCGACCGGACGTCGCTGGTGGAGGCGGCAGACGGGGACGGAGAGACGGAGGCAGAGGCGG
AGGCAGAGGCGGCGCAGATACTGGCGCTGCGACGCGACATCATCCACGTGCTCTGCTTCCGGCCGCTGTCGTACTCGGAC
ATCTGCAACAAGCTGCCGGACCGGTACCAGGAGCAGGAGAACTTCCAGAAGGTGCTGGAGAGCCTGACGGTGTTCAAGGC
GCCCGACGGCAATGCGGACGTGGGCACGTTTGAGCTGGAGGCACGACACATTGAAGAGGTCGACCCGTACATTGCGCACT
ACAGCAAGAACCAGCGGGAGGAATCGGAGACGGCGTACCGGCGGTGGATGGCGAAGAAGACGGGCCGACCGGTAGAGTCG
ATCGTGTACGAGCCACGGCTGCGGCCGATCCGATCAGGGGCGTTTGTGGGGCTCAGCAACTTCACGTCGACGGGCATCTT
TGCGCAGCTGGTGTACTACTCGCTGCTGTACTCGCTGACGGCCGGCCAGCTGACGCCGGCGGTGCCGATAACGCGGGTCG
AGACGTTTCTGCAGGTGCTGCTGCACCTGGTGCTGATTGCGATTGCGGAGGACAAGACAGGAGAAGGCGAGGGAGAGGAG
GAGAAGGGGGCGTCCTTCATCGAGCTTGCGCTCAATAAAGTGGCGCGGAGCAACTTTATGGCGTCGGCGCCGGCAGCCAA
GACGATTGTGGCGCTGCTGGACCTGATGTCGACGCGGGAAGAGCTGAAGTCGTGCCAGCCCAAGATCACGCTGATCCTGA
AGCGGATGCGGCAGAAGCGACCACAGGGATTTGCAGCGGCGTACGCGCGCTTGGGGGTGTCAGTGGAGCGGATCAGCACG
GCGTCGCCGGCCAACAACCAAGACGCGGAGGAGGAGCGCGAGCGGAAGAAGCGGGCGGCACTAGCACGACAGGCACGGGT
GATGGCACAGTTTCAGGAGCAGCAGAAGAGCTTTCTGGAGAAGCAGGGCGATGTGGACTGGGGCACGGTAGACGAGGAAC
TGGACGAGGAACTGGACCAGACGTCGTCACAGTTGCCGACGGAAAAGAAGGCGTGGAAGTATCCGGGCGGGACATGCATC
TTGTGCCAGGAGAACACGGACGAGCGGCGGCTGTACGGGACGTTTGCCTTTTTCACGGACAGCATGATCCTGCGACAGAC
GGACCTGCAGGATGCGGACTTTGTGCGGGAGGCAGCGTCGACGCCACGGAATCTGGACCGGTCGGCCGAGAAGCTGCGGC
CGTTTGGGGTGGCGGGCGAGAACCGGTCGACGGTGGTCAAGATCAGCGCGGAGGGCAAGGCGTTCGAGACGGAGCGACAA
GGCATCGGCAAGGGCTTTCCGGCGCAGAACTGCCATGGCGGAACGCTGTCGGTGGGCTGTGGCCACATCATGCACTACCA
CTGCTTCGAGGCGTACTTTGAGGCGACGCTGCGACGCCACCACCAGCAGATTGCACGACACCACCCGGAGGACACGGAAA
AGCTCGAGTTTGTGTGTCCGCTGTGCAAGGCGCTGGGCAACGCTTTCCTGCCGATCGTGTGGAAGGGCAAGGAGGAATCG
TACCCGGGAGCGCTGGAGGCGACGCAGCCGTTTGGCGATTTTCTGGACGGCCAGATGACGGGGACGCGACAGGTGGCCGA
CGGGATACTGAAGCAATTTGCGCGGTACATGACGACAGCGACGATCGGATCAGTGCAGGAACGGACGGCCAGCCTGGTGT
CAGAGGCGTGGGAGCCGACGATGCGACCAAGCAGTGCACTGTCGGCGGTTCTGCTGACGAGCCCGGTCACAGTGGCATCA
CTGCTGCCGATGCACAGCCACGGCCACGGATTCGGACAACGGGCAGCTCTGAGTGGCGGCGGCGGCGGTGGCGGCAACAT
TGTGCACGAGCTGGTGGGAGTGTATCGACGGCTGTGCATGACGCTGTGGACAAACGAGCTGCGGTCGCAATTCCGGGCGG
AGGGCGAGATGCTGGAAGGCGAGCTGTGCATGAGCGACACGCTGGCACAGGCAGTCGGCTACTCGATCTCGGCTGTGGAG
ATCCAGCAGCGCGGCACAGACGCAGAGTACGGGATGACGCTGCTGTCGAAGATCCCGGAGCAGCAGATGACGCATCTGCG
GGTGCTGTGCGAGACGGTGACGTCGTACATTGCAGTGGGAGCGCACCGACGGGCGGGCAACAACCGGGTGGAGGGCGAGT
TCCGGCGCGACAGCGAGCGGCAGCACTGCCAGCTGTTTGCGGCGCAATACGCGAACGAGGACGAGGAGACGGAGTCGACG
GATCTACGGCTGGACCGTTACGCACCGCTGCTGAGCTTGGACCCGTTTGTCTTTCTGTGCGAATGCGTGTTCGGCGTGAT
GCCGGCACAACAGCTGCAGATGGCCCACCTGGTCCGGCTGTGCTATCTGGCCGAGCTGGTCAAGGCGGTCTACCACATGG
GGCGCAACTTTTCGAGCGCGGCGTGGGTTCAGCTGGTGGAGGCTCAGCAGGCGGCCGAGACGACCGAGCCGATCCGTGGC
TTTGCCGAATTCTGTCTGGGAGTCATGCGGCTGACCGTAGGAGCCGATGGGACGATGCCAGCCAATGGAACGAATCCGGT
CGATGCACTTCGGAACCGTGCATTCGATCAGGACGGACTCCACACGGTCGAGGGCTACTACAACTTTACCAAACGGTACG
CGCTCGTGTTTCTGCGCAAGACAGCCGTTTTGCTGCATGCGCAAGCCGGCGTCGACTTCAACAGTCACGTGTCGCCAGCA
CCGGAGCTGGACGAGCTGGACCGCCTGAGCGAGGCGCTGCGGCTGCCGTCGTTTGACGACATGTGCACGGCGCCGACAGC
AGGAGGCGCGGCGCACGGTTGGCCCGCGACGACGACACGGCTGGTCGCCGGATGGCTGCAGCACAGCGTCCGGGCACTAG
ATCGAGCACCGACATCATCCGCGAACCCATCGGCCTTGCTTAGTCATCCGGCCATCTACGAGCTCGTGGGGTTGCCACGC
CACTTTGACCAGCTGTTGGACGCGTGCACGCGCTGTCGCTGTCCGACGACGGGCAAAGACGTGTCGGACCCGATGATCTG
TCTGCTGTGCGGCACCGTCTTCTGCGGCCAGGCCATCTGCTGTCTGAAGGAAGAGAAGGGCGGACGACGACAGGCGTGGC
GGAAGATTGGGGGGGCACAACAACACATGAGGAAGTGAGTGTTCGGACGAGAGAGGGACGAGAGAGAGAGTGGAGAGAAA
AGCTAACAAGCCAGATGCCAAGGAAATATCGGCCTCTTTCTCAGCATCCGAAAGTGCTGCATCTTTTACCTGCACCGGCT
CTCGGGATCCTACGGCTATGCCCCGTACATTGATAAGTACGGTGAGGTTGACTTGGGCTTCCGACACGGCCGTCCATTGT
TGCTGAATCAGCGCCGCTACGACCTGATGTTGCGGGCCGTCTGGCTGAGCCACGGCATACCCAGCTTCATCAGCCGCAAG
CTGGAGATGGACATCAACAACGGGGGATGGGAGACGGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62