GenePrediction:GLEAN_2493 Details

Name: GLEAN_2493
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1455172..1456920 (+ strand)
Length: 1749
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1455172..1455255 (+ strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_140:1455338..1455880 (+ strand)
Length: 543
Type: CDS
Source: GLEAN
Position: GCSC_140:1455956..1456637 (+ strand)
Length: 682
Type: CDS
Source: GLEAN
Position: GCSC_140:1456715..1456920 (+ strand)
Length: 206
>GLEAN_2493 class=GenePrediction position=GCSC_140:1455172..1456920 (+ strand)
ATGTCTCAGCCTCAGGGAGTCTTTGGCCTCGAGGTGCCGCCTGGCGGCGTCCTCATCCCGGCTGTCCTGAACTTCCCGGC
CACTGTACGTCGTCTCTATTACTCTGAATCCTGCTCCCTCACTCTCGGGGCAAGACCTGTTCCGTCCTGTTCACTGACTC
TTCCAGATCGCCATCTCCATGGCTGCTATTGATCCCACCGCCGAGCCTGAGGCTGATGAGGAGGGCAACATCCCTACCAC
TGGCCGCTCTACTCTGCGCATTGTTCGCCGTCCTATTGATGACGAGAGCGACGATGAGGACGAGGAGGACGAGTACCTCC
GCAGCATCCTTGCCGGCAGCGACGACGACGATGACGAGGACGACGACGAGCCCAACGGTGGCCCGAGCGACCCCTCCAAG
TCTCCTCGCCGCAAGGACATCAAGGCTCTTCTTGATGCTCTTGCCGCCGAGAACGGTGACGATGACGAGGACGAGGACGA
GGACGAGGAGATGGAGGATGTCGGCGCTACCAAGGGCAAGAAGAAGGCCAGCAGTGCCAAGGTATCCAAGCCTTCCAAGA
CTTCCAAGAAGGGCAAGGAGCCCGCTACCGTCGAGGACGACGAGGACGACGAGGACGAGGATGAGGATGACGAGGATGAC
GAGGACGACAGCGACGACGAGGATGTCGTCCTGGAGGACTTTGTTCTGTGCACCCTTGACACCGAGAGAGTATGTTGTTT
TCTTCTATTTATTCTTGAGCACCCTCCATCCCGCTTTACGACCACTGCTAACACTGCGAAACAGCTCTACCAACAACCCC
TCCAGATCGAGATCAACGCCGGTGAAACCGTCTTCTTCACCGTCACCGGCAGCCACGCCGTCCACCTGACGGGCAACTAC
ATCGTCGAGGACGACGAGGATAGCGAGGACGAGGATGATGAGGACGACGACGACTACGACCTCCCGCCCGATATCGACCT
GGAGGAGCTGGACAGCGAGGACGAGGACGAGCTTGACGAGCTCGACCTCATCACCGGCCGCGTCGAGGAGGTCGACGACG
ACGAGGTCGCCCCCAAGCTGACCGAGGTCAAGAAGGGCGGCAAGAAGCGCCCGGCCGAGGATGTCGCCGAGCAGACTCTT
GACGACCTGATCAGCAAGGAGGCCAAGGGCGCCGAGACCAAGCTCAGCAAGAAGCAGCAGAAGAAGCTCAAGAACAACCA
GGGCGAGGCCGTCGGTGTCCAGAAGCAGGAGGACGAGAAGAAGCGCGTCCAGTTTGCCAAGAACCTCGAGCAGGGTCCCA
CCGGCTCGGGCGCTAAGGACGCCAAGGATGCTAAGGACACCAAGGGCAAGACCGCTCTGGGCGTCAAGGTTGTTCAGGGC
GTCACCATCGACGACCGCAAGCTGGGCTCCGGCCGTATCGTCAAGTCCGGCGACCGTGTCGGCATGCGTTATATCGGCAA
GCTCGAGAACGGCAAGGTCTTTGACTGTATGTTTTCTCTCTCGTCTACTTTTGCCGCCATCTTTTCTCGCATCTGTTGCA
GCAGCTAACTCGTCTCCAAACAGCCAACAAGAAGGGCCCTGCCTTCTCCTTCCGTGTCGGCAAGGGTGAGGTCATCCGCG
GCTGGGACATCGGCATTGCCGGCATGGCCATCGGCGGTGAACGTCGTCTGACGATCCCGGCTCACCTTGCCTACGGCTCC
AAGAAGCTGGACGGCATCCCGGCCAACAGCACCCTGATTTTCGACGTCAAGCTCCTGGAGATCAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62