GenePrediction:GLEAN_2496 Details

Name: GLEAN_2496
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1474599..1475469 (+ strand)
Length: 871
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1474599..1474626 (+ strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_140:1474733..1474810 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_140:1474934..1474995 (+ strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_140:1475095..1475118 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_140:1475183..1475189 (+ strand)
Length: 7
Type: CDS
Source: GLEAN
Position: GCSC_140:1475254..1475340 (+ strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_140:1475399..1475469 (+ strand)
Length: 71
>GLEAN_2496 class=GenePrediction position=GCSC_140:1474599..1475469 (+ strand)
ATGTCAATCGAAAATCTCAAGATCAATGGTACGTGTGTCCTGGACTCTTATGGCATATCCCATACGCCACGTCTGGCCTA
CCAGCGTCTCCGGCACCCTCCAGTTGAGCTAATCGTGCGGCATTTGAACCACAGATCCCTTCGCCGACGCCGACGAAGAT
ACCGGACAATCGCAGGCCAACAAGCAGGAGTACCTCCATATACGCATTCAACGTACGTCACGTCTCCTTCACTGGAAAGA
GCGCCGGATTTGCGGTCTTCGCGAGACGAACGCGTTGAGCATCCCGACCGCTCAGCTAGACTATTAAGGGGTTGCTGACA
TCTCGGGTTCTACAGAGCGCAATGGACGCAAAACCTTGACCACAGTCCAAGGCATTCCCCCCAAGTTTGACCACAAGGTA
GGTTATTCGATAGGCCAGCTAGCCACACTTCCAGCCTTCATTTCACGCGTCATTTTCAAGCTCCGTCGGTCTTTGATTTG
CTAACGCGCCATATAGAAAATCCTCAAAGTCATCAAGAAGGTTAGTCTTTTGGTTGTTTCTCTACGTTTGATTGCACTGA
GGACTAGAGCTGACCCCAACATAGGATTTCGGTTAGTACACCTCGACAGAAGCTGGACATGAATGACTCGGTATGAAGCT
AACCCCTATTATTAGCTTGCAATGGAACGATCATCTCCGCTGCGGAGTCCAAGGGCATGGGCGAAGTGATTCAGCTCCAG
GGCGACCAGCGCAGCAAGATCCGTAAGCATGTGTCCGCGACAACAGCAGCACAACCGCCATGACTGACTTACTCGACTAG
GTGACTTCCTTATCGACAAGGATAATGGACTTGGTCTCGATGAGAAGACCATCAAAGTCCACGGCTTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62