GenePrediction:GLEAN_2497 Details

Name: GLEAN_2497
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1478647..1481316 (+ strand)
Length: 2670
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1478647..1478923 (+ strand)
Length: 277
Type: CDS
Source: GLEAN
Position: GCSC_140:1479000..1479145 (+ strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_140:1479208..1481316 (+ strand)
Length: 2109
>GLEAN_2497 class=GenePrediction position=GCSC_140:1478647..1481316 (+ strand)
ATGCCGGGACCTAAGGCGACCAAGCTGGGCCACGCCTTGGCAAAGGGCCTTGGGATCAAGCTTCAACCACCCATTCAGTA
CCAGGACGAAGTGACTCGAGGGGAGTCTGTCTTCTCCAACAACGCCTATGTCGAGGAGCCGCCACGCACCATCGATGAGC
TGCGCGAACTGGTTCCGACTGGGAATCAAGTTTGGGATTACGTGGTTTCGCTCTTCCCCTTTCTGCAGTGGATTGGCCAT
TACAATACTCAATGGTTGATTGGTGACCTTGTTGCGGGTATGTTCATGTCCTCATCTGCGCCAGCTGCCGCGACGACTCA
TGACGAAAGCGCAATTTCTAACAAATTGGACAGGCATCACTGTTGGCGCCGTCGTCGTTCCCCAGGGCATGTCGTATGCT
CTCCTGGCCAATGTTGAGCCCCAATTCGGACTTTACTCGTCTTTTATGGGTGTTCTAATCTACTGGTTTTTCGCGACCTC
AAAAGACATCACCATCGGCGTACGTCTTGTCCCAAAATGCATTTCCCTACTGTTGCCTGCTTTTGCTAACTGACTGCTCA
GCCCGTGGCCGTCATGTCCACACTGACAGGCACCATCGTCGAAAAGGCAGCCGTCAAAATCCCAGACGTACCAGGACACG
TTGTCGCCTCCGCCCTCTCTATCATTGCCGGCTCTATCGTCCTCTTCATCGGACTCATCCGCTGCGGCTGGATTGTTGAC
CTCATTCCCCTAACGTCTCTCTCTGCATACATGACTGGCTCGGCCATCAACATCTGCTCTGGCCAGGTTGCCGGCCTGCT
GGGCGAATCCGGATTTAACACCCGCGCTGCCACATACAAGGTCATCATCAACTCGTTCAAGTACCTGCCGAAAACCAAGA
TCGATGCCGCCATGGGCCTGACTGCCCTGACCATGCTTTATCTGATCCGCTTCGCCTGCAATTTCTTCGCCAAGCGCTAC
CCCAAGCACCGGCGCATGATCTTTTTCGCCTCTACGCTGCGCACCGTTTTTGTCATTTTGCTGTATACCATGATCAGCTG
GCTGGTCAACAGACACCGCCGCAAGCACCCGCTCTTCAAGATCCTCAAAAAGGTTCCGCGAGGCTTTAAGAACGCTTCTG
TCCCCGTCGTGGACGAAAGAATCATTCGCAGCTTCATAGGTGACCTGCCCGCCACTGTCATCGTCCTCCTCATCGAGCAC
ATTGCCATCTCCAAGTCCTTTGGCCGTGTCAACAACTACACGATAAATCCCTCGCAGGAGATGGTCGCCATTGGCGTGGC
CAACGTCCTGGGTCCCTTCCTGGGCGGCTACCCCTCGACCGGCTCGTTTAGCCGCACTGCTATCAAGGCCAAGGCTGGTG
TGCGCACGCCTTTTGCGGGCGTGATCACGGCACTTGTGGTACTTCTTGCCATCTACGCGCTGCCACCTGTCTTCTTCTAC
ATTCCCAGCGCGACTTTGTCGGCGGTGATCATCCATGCCGTCGGCGACTTGATCACGCCGCCCGACGTCGTCTACCAGTT
TTGGCGCGTCAACCCATTCGAGGTGGTCATCTTCTTTGTGGGCGTGTTTGTCACTATCTTCACCACGATTGAGAACGGCA
TCTACAGCACGATTTGCATCTCGGCCGCCATGCTGCTGTACCGCATTCTTCGGACTCGGGGCAGCTTCCTGGGCCGCGTA
AAGGTCCAGTCTATTCTAGGCGATCAGGTTATCGGCCAGGACAGTCGCCTGGCGATTGCTCCGTATGGCACTATTTCGAA
CCTGGACATGGAAGTGCCTGCGCGTACGGTCTTCTTGCCACTCGATCACCAGGACGGATCAAACCCGGACGTCGATTTGC
AATCCCCTTACCCCGGCGTCTTCATTTACCGCTTCGCGGAGGGTTTCACATACCCCAATGCATCACACTCGTTGGAGCAT
TTGGCAGAATACGTGTTCAAGCATACGCGGCTCACCAATCTGACCTCGTTTCCCCGCCCTGGTGACCGGCCATGGAACGA
TCCCGGTCCGACACGCCGGCAGCTGAAGAAGATCGCGGAGGGCGATGTGAACGCAATAAACGCAGCCGAGTACAACAGAG
ACCTGCCGACTCTAAAGGCCATCATTCTCGACTGCTCCTCGGTCAACTTTGTGGATGTCACGTCAGTGCAGGCCCTGATT
GATGTGCGCAACCAGCTCGACCGCTACGCGGCTCCTGAACACGTCGACTGGCATTTTGCGTCAATCAGCAACCGCTGGAG
CAAGCGCGCCCTGATATCTGCCGGCTTCGGCTTCCCGACCGAGTACCAGGATACGCCAGAACAGCGGTGGCGAGGCATCT
TCAGCGTGACCCCGTCCGGCGACAAGCATGAGGCGGACGGCGAAAAGATCGAGGACGGCGAACTACGTCGAACGTTGACG
TCGACAACTGCTAGCGCAGCCAAGACTGTGACCCTAGACATCGAAGAGGCGCGCAGCAGCGGTGACGGAGTCGGCTCGGG
CGACGACGACCCGAAGCTGAACCTGCAGGGTCGGTCGGCTCACCGCATCCGGGGTATTGCCATCCACAGTCTGAACCGGC
CGCTGTTCCACGTCGACCTCACCAGCGCATTGCAGTGTGCCATTGCCAACGTGGAAGCTCGTGAGGCAGCCTCGGCCGAC
TCGCGGCCAAGCTCGATCAAGGGATTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62