GenePrediction:GLEAN_2498 Details

Name: GLEAN_2498
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1483014..1485190 (+ strand)
Length: 2177
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1483014..1483068 (+ strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_140:1483154..1483429 (+ strand)
Length: 276
Type: CDS
Source: GLEAN
Position: GCSC_140:1483497..1485190 (+ strand)
Length: 1694
>GLEAN_2498 class=GenePrediction position=GCSC_140:1483014..1485190 (+ strand)
ATGGCACCGTCTACGAAAGCTCCCAACTTGGGGCAGATTATCGAGTATCTCCCGGGTAAGCCGCCATCTCTGCGTCATCC
GACTCTCGCTCCTGCGGCTTCTCCTGCTGACTAGGCTCTTGTTGTTTTCTTCCTCGCCAGACCGCCTTTATCTCGCCTCT
TATTTGAGCCCGCCCGATGCCGACACCCTCTTCCCGTTTGGCAACACGGCCAAGACGAGCAGGAGACACAGGTCTGGACG
CGAGCCGTTCTACTTCACCGTCGATGACTCTCTCCTCTACAATGCCTTTCACCACGACTTTGGCCCGCTGCACGTCGGTC
ATCTGTACCGCTTTGCCCTGCACTTCCACGAGATTCTTGCAGCAACAGAAAACCAGCAGCGGCCAGTCGTCTTTTGGAGC
AAAGCAGATCCCCGAAGTAGGTTGATTCCTGGCGCCTTGCTTCCGTGTCGTTGGCGCCTGTTCCCTGCTAATGATCACCC
CAGGCCGGGCCAATGCATCTTGTCTGCTGGCGTGCTACATGGTACTGATTCAGTCATGGCCGCCCCATCTGGCTCTGGCC
CCGATTGCTCAGGTCGACCCGCCATTGATGCCGTTCCGCGACGCCGGTTACAGCCAGGCCGACTACGGCATCACAGTGCA
GGACATTGTCTACGGTGTCTGGAAGGCCAAAGAGGAGGGCTGCTGTGTCCTCGACAGCTTTGACCTGGCCGAGTACGAGA
CGTTTGAACGCGTGGAGCACGGCGACTTCAATTGGATCACGCCGAACTTCCTGGCCTTTGCGTCGCCGCAGCACGACCCT
GTGACCCGGATCACGGAGACGTCGGAGCCTGAGCTGTACGAGTCGCTTCCGCGGACGCTGGATGCTGTGGATGCACACCC
GACGCTGCCGCAGCCCTTCAAGAACGTGCTCCGGCATTTCTCGGAGCGCAACGTTGGGCTTGTGGTCCGGCTCAACTCGG
CGCTGTACTCGCCGTCGTACTTTGAGGCTCTGGGCATCCAGCACCTCGACATGATCTTTGACGACGGCACCTGTCCGCCC
ATGTCGACGGTCCGCAAGTTTGTCCGGCTGGCACACGAGATGATCAACGTGCGCAAGAAGAACATTGCCGTGCACTGCAA
GGCCGGACTGGGTCGGACAGGCTGTTTGATCGGTGCCTACCTGATCTACCGCCACGGCTTCACTGCGAACGAGATCATCT
CCTATATGCGCTTCATGCGTCCGGGTATGGTCGTGGGCCCGCAGCAGCACTGGCTGCACCTGAACCAGGGCATCTTCCGC
GAGTGGTGGGTCGAGGAGCGGGTCGAGCGCAAGCTGCGCCGGGAATATGCCGCTGCAGCTGCGGCCGCGTCTGCTGGCGC
TGGAGGCAACCTGCCGAGCACGCCGATTCGCGCGATGCAGAAGGCCAATCTAGGCCGGTCAGCCCAGCATCATAATCAGC
ATCCGCAGCCGGCATCGACGCCGCCGAACCGCAGCGTCTCAGGCCGCTCACCACTCAGCGAGATGGACCAAGAACGCACG
AATGCCGCGCAGGAAGACTATCTTCCAGCTCCGACTCCGGGACAGCCTCGCAAGGCAGTTCGGTCTGACCGGCACCACCC
GTACTCGCGCAAGGCCAACTTCACATCCACGGTAGAGGAGGCGACGGAGACGGTGGTGCACGAGGACGAGGAGGCCGAGC
TGTATGTGGTCGAGCAGGAGAAGAAGGGCAAGGACGGCCATCGGTCCAGTGGTGACAGCCGCAGTGCCGATTCGGAAGAG
GAGGTGTATCTGCGGATGCGCGCACACCGAAAGACGACAACGACGACCACGACGACGGTATCGTCGCCAGATGCTGCTGC
ACGACATCGCAAGGCACGATCGGCCAGCCACAGCACGGCGGCGATACTGGCGGCAGCCCTGGAAAATGACGCGTCAAATG
ACGCCGAGAACATCGGTTCGGCCATACAGCGAGTCAAGTCGATCCACAACCACGAGGGCCAGCGCTCTAGCTCAGCGTCG
GTCGTGATGGCCAAGGTGCGCAGCTCGGAGCGGACGGCCAGCGCGTCGGCAAAGAAGATGGCCAGTGCACAACCTGTGGG
AATACGCAAGACCAGCGGTCGCGTGGGCAGTGCCGGCAACATGCCGTCAGTGGCGGCCATGGCGTCAGCGCAGCGCAAGA
TCTCAGGCATGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62