GenePrediction:GLEAN_24 Details

Name: GLEAN_24
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:180401..183375 (+ strand)
Length: 2975
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:180401..180417 (+ strand)
Length: 17
Type: CDS
Source: GLEAN
Position: GCSC_179:180486..183375 (+ strand)
Length: 2890
>GLEAN_24 class=GenePrediction position=GCSC_179:180401..183375 (+ strand)
ATGGTGAAGTCATACTTGTGCGTGGGCGGTGATTGTGGTTATGGGGCCGTGGCGGGCAGTAAATATGCTGACAATGAGTA
TGCAGAAAATTCGAGCACGCAAGGTCCTTTGGCGTTGTGACGGCGAGCACGTCCAACGTTGTGTGGACAGGCCAGCAGCG
ATCGGGAACAGGAGCGGGCCAGGCGATTGTGGCAGCCAACGAAGATGTGCTCTGCTGGGACATCAAGAAGGGCGAGCTGG
TGAGCCGATGGCACGACGAGAAGAACAAGGCGCAGGTGACGGCGATTGCGGAGAGCGAGGTGGACAAGGACATTGTGGCC
GTGGGCTACGAGGACGGCAGCATCCGGCTGTGGGACGGGCGGCTGGCGACGGTGATTGTGAGCTTCAACGGGCACAAGTC
AGCGGTGACGCACCTGGCGTTTGACAAGGCGGGCGTGCGGCTGGCGAGCGGCTCCAAGGACACGGACGTGATCGTGTGGG
ACCTGGTGGCCGAGACGGGGCTGTATAAACTGCGCGGCCACAAGGACCAGATTACGGGGCTGCGGTTTGTGGAGCCGGCA
GCAGAGGACGAGGAGGAGGAAGCGGCAGCGACAGCGGGCGAGGGCTTTCTCCTGACGACGTCCAAGGACTCGCTGATCAA
GCTATGGGACCTGTCGTCACGGCACTGCATCGAGACTCACATTGCACAGCGCAGCGGAGAGTGCTGGGCGCTGGGGGTGT
CGGCGGACCTGAGCGGATGCATCACGGCGGGCAACGACGGTGAGCTGCAGGTGTGGGCGATCGAGACGGCGGCGCTGGCA
GCATCGACACAGCGAGTGGAGGTGACCGGATCGGACAAGTTTCTGGTGGCGCGCGGCACGCTGCACCGGCAGGCCAAGGA
CCGGACGGCCGAGATCACGTTCCACCCGCGGCAGGGCTACTTTGCGGTACACGGGGTAGAGAAGTCGGTGGAGATCTGGC
GGGTGCGGACGGACAGCGAAGTCAAGAAGGCGCTGGCACGGAAGCGGCGGCGAAGGCGAGAAAAGGCGGCAGCGACGGCA
GAAAAGGGCGGCGACGTGGACATGGGCTCAGGGCAGGAGGACGAGGGGGTGTCCTCGGCCGAGATGGCGGACATATTTGC
TTTGCACGTGATGGTACGGACAGCAGGCAAGGTGCGGTCGGCGGACTGGGCTCTGGGCAGCGGGCGGAAGGAGCTGCAGC
TGCTGGTGGGGACGACGAACAACCTGCTGGAGCTGTACACGATATCGACGCGCAAGGAGCGGGCATCGAAGAAGGCAGCG
GCAGACGAGGAAGAGGCAGCGGCGAGCTACAGCCGAGCGCTGGCGGTGGAGCTGCCAGGACACCGGGCAGACATCCGGTC
GGTAGCGCTGAGCTCGGACGACAAGATGCTGGCGACAGCGGCGAGCGGCAGCCTGAAGATCTGGAATGTGCGGACACAGA
CGTGCATCCGGACGTTTGAGTGCGGCTATGCGCTCTGCTGCGCCTTTCTGCCGGGCGACAAGGTGGTGGTGGTAGGCACG
AAGACGGGCGCGCTGGAGCTGTTTGACGTGGCGTCGGCGGCGCTGCTGGACAGCGTGGAAGCGCACACGGGAGCGATCTG
GGCGCTGCAGGTGCACCCAGACGGTCGTTCGGTCGCGACGGGCAGCGCCGACAAGACGGTGCGGTTCTGGGACTTTCGGA
TCGTGCAGGAGGCGGTGCTGGGAACGACACGGACGGCACCACGGCTGCGGCTGGCGGCAACGCGCGTGCTCAAGGTGGCA
GACGACGTGCTCAGCCTGCGCTTCTCGCCCGATGCGCGGCTGCTGGCGGTGGCGCTGCTGGACAGCACAGTCAAGGTGTT
CTTTGTCGACTCGCTCAAGCTATTTCTCAACCTGTATGGGCACAAGCTGCCGGTGCTGAGCATGGACGTGTCGTACGACA
GCAAGCTGATCGTGACGAGCAGCGCCGACAAGAACGTCAAGATCTGGGGCCTGGACTTTGGCGACTGCCATCGCTCGCTG
TTTGCGCATCAGGACAGCATTCTGCAGGTGGCGTTTGTGCCGCACAACGGCGACGGCAACGGGCACCATTTTTTCAGCTG
TGGCAAGGACCGGGCCATCAAGTACTGGGACGGCGACCGGTTCGAGCAGATCCAGCGGCTGGACGGCCATTTTGGCGAGA
TCTGGGCCATGGCCGTCAGCCACAGCGGCTCGTTTGTCGTCAGCGCGAGCCACGACAAGAGCATCCGGGTCTGGAACGAG
ACGGACGAGCAGGTCTTTCTGGAAGAGGAGCGCGAGCGGGAGATGGAGCTGCTGTACGAAAGCACGCTGGCGACGTCGCT
GGAGCGTGATGCCGACCCGGAGGACGCCGGCTTGGACGGCCAGCCGGCCGATGTCGGGCTCGCGTCTAAGCCGACCACTG
AGACCCTCATGGCCGGCGAGCGCATTGCCGAGGCCCTTGAGCTGGGCATGGCCGACCTTGTCACGCTGCACGAGTGGCGC
GAGACCCGTCGTCGCCAGCCCGGCGTCGTCTTGGCGCCGCCGCAACGCCACATCGTCTTCACGGCTCAGGGCAACCTTTC
GGCCGAAGATCACGTGATGCGCGTCCTCAACCGCATTCCTGCTGCCGCTCTGCACGACGCCCTGCTCGTGCTCCCGTTCG
CCCAGCTGCCTGCGCTCTTCACCTTTCTTGACCGCTTCGTCCGCCGCGCCATGAACGTCCCGCTCACCTGCCGCGTCCTG
TTCTTTATGCTCAAGACGCATCACCGTCAGATCGTCGCCAGCCGCACCATGCGCGCGACCATCGACGGCCTCCGCGCCAG
CTTGCGCGCCGTCCTGCAGGAACAGAAGGACCAGATGGGCCACAACATGGCTGCGCTGCGCGTCGTCGCCGCCCAGGTGC
GCGACCAGGCCGTCAAGAACTACGTCGACGAGACCTGGGAAGACGTCGACCCGGCGCAGAACGCCCGCAAGCGCGGCTTC
GTGCAGGTGTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62