GenePrediction:GLEAN_2501 Details

Name: GLEAN_2501
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1528238..1532895 (+ strand)
Length: 4658
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1528238..1528280 (+ strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_140:1528696..1529739 (+ strand)
Length: 1044
Type: CDS
Source: GLEAN
Position: GCSC_140:1530406..1531009 (+ strand)
Length: 604
Type: CDS
Source: GLEAN
Position: GCSC_140:1531074..1531158 (+ strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_140:1531223..1531385 (+ strand)
Length: 163
Type: CDS
Source: GLEAN
Position: GCSC_140:1531450..1531473 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_140:1531534..1531601 (+ strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_140:1531658..1531719 (+ strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_140:1531776..1531921 (+ strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_140:1531982..1532070 (+ strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_140:1532133..1532249 (+ strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_140:1532323..1532895 (+ strand)
Length: 573
>GLEAN_2501 class=GenePrediction position=GCSC_140:1528238..1532895 (+ strand)
ATGAACGATCACCGTGCGTTTCTTGACCTAGTCACAACTGCCGGTAAGTATGTACCTCCCGAACAGTTCGTTTCTCTCAG
GCCGTGCTTACTCGTTGCGAACAGATAGCTTGTGTGCCGATATCACAAAACTACGCTATATTGATTGGAACAGTCCAGTC
TCGCACTGGATCCCTGCTATCAAGAACCTCATCACAGACTGCCACAGCAAGCACGATCATTGCCAGCCCCTTGAGCCAAA
GCCTCTCCCACTAAGGCTCCTACAGGCTCAAATCAACTAGCCATATTTGTCCCAAATACGCCTGAGTGTGGCTCCGCGAA
ACAAGGATGAGCTTGGCCTCTATGCCGCCCTCAGTTACTGCTAGGGCGGCCCGCAACGGCTGGAGCTAACCACGAGCAAT
ATCCATGCCTTGGAGCAAGGGATTGATACAAAGTCTCTCCCACAAACTCTGCAATAAGCGATTCTCGTCACACAGCTCCT
CGGACTAGAGTATCTGTGGGTGGATGCTTTGTGCATCATCCAGGATGATGACGCCGACAAGGCCGCGCAGATCTCCCAGA
TGCATGACATTTACGAAAATTCGGCGGTAACGATTTCAGCCGCTTCTGCAAGCTCCGTTGAGCAGGGGTTCCTGTCGTTC
CATGGCTGGCATACGGACAAGAATCCTCGGTGCGACTTGGCTGTACGCTTTGATAACAATGAGCTGGCCCCTCTTTATCT
GGTCCCCGCGTACATCCACCAAACGAACGACTTTCCTATCCAGAAGCGAGGCTGGACACTGCAAGAAAGCATGTTGCCCC
CGCGGCTGCTGGTCTTTGGCGATCTAGAGCCATATTTTTGCTGTCGGAAATATAAATATGTGCATGTCGCCGGGTCACTC
GTTCGTTACCAGGACGTAAAACTGCCGCGATTCAATAGCGACGGCTCGACAGGCTCCTCCTCTACCGCACTCCAGTTTCG
ATACAGGGAGGCATGGACCCAAGTTATCGAGCAATATACAGATCGCACGCTAGGTGTTAAGGAAGATCGCCCGTTTGCTA
TAGCTGGCGTGCAAACTTGGCTCATCAACATCTTAGAAGACGAGTGCTACTTTGGCGTTTGGAACTCACGAATCCTAGAG
GGCATTTACTGGAAGGTAGAGCACAAAAAAGGCCGAGAATCAGGGCACATCACAAACTGTCCCAGCTGGTCGTGGATGTC
CGTCCTAGGAAGGGCCAGTACGGGGTTTGCGTTCTACAAGTTTTATGCTCGAACCACGGCTGAATGGGGCATCGACTCTG
ATCATCGAGAGGTCATCTTGCATTGTCATGTCCTTACGCTGGCCGACGTCACTTCTAGTGATGTGCGGGAATCATGGCCA
GATGTTGTTACAGAAGAAGACATAGACATGGGCATAGGGACTGATGGGTCGATCAAGAACTATCGCTGGGCGGACGACGT
GTGTTTTCTCGGCCTGTACGAAAATTACAACTTTTTGAAGGCCCTCGCTGCAAGAAGCTATGGTGATGATGTTTATAAGC
GCGTTGGACTGGTGAATCTGGCGTGTGCACCGAGGTGGTTGAAAAGCCCAAAGAAGAGGGTTATTTTGAGGTGATCTGAA
GGGATATGGTATGGTGACCTATCGGTGGCCACAGGTAGACTGGAGCGTGGCATCCTGATGCTTGAATCGGCGGTGATACT
AGGCGAAGTCTCCGTGCCCAGTGCGATGGGCGAGGTATATTTGTAGCTGCTTGCGTGACAATAGCCGGACGCTGGGTAGT
CTATTCTTTTGGTAATCCCTCCGTTCTGTGGCTTCTCTGTAACGTCTGCTAAGTGACTGCCTCGTGGCGTCCCACTGAGT
CCAGGAAGCCGACTTCTATCATTTAAGGGCACCACGTCTGTGTGGGATCGCCCTGTCGTTTTAGCGCACGCATGGGTCAC
GTGAGAGCCAATCAGATGCCCCATTCGCGTCTCCAGCTGCCAGCGCGAACTAAGTGACGTCTTGGAAACTTGAACGGGTC
CGTTTCGGAGAACAAGCTACGACACAAGTCAGCGCGCCACGCCCGCAAATATCGCCGTCTATCGACCATCCTCGTTTTGG
TAGGAAAGAGTGGCTTAAAAAGAGAGAAGTGAAAAAAGAGAGAGAGAGATGCCGGCCCAGCAGTCTCAGAGCCTCTCGGC
TTCGTTAGGAGGCAGCAGCAGCAGAAAGACGAGATACCAGCAGGTAGCTACGACCGATGTCGGCGACAGGGACCTCGAGG
AAGACCGCATCTATAGCGGTGAAGAAGTTGACGAGGAGAGCAAAGCGGCAGCCAGAGACGAGACGACAAGCTTCATGTTG
CCGCAGAGCCCCTATCCGCCGCCAGCAGCACTGTACCATCGATCCGGCGAAGGGGCTTCGGCCTGGCTTTTGCGACGCAC
ATTTCGCACCGTGGCCATCGCCTTCCTGACCTGTCTGTTCGTCTGCGTGGGCTTCAAGTTTGTCAGCGATAACAGCGGCC
TGTCGCTGGTGCTGCCCGACCACAGCTCACACCACGAGGGCAAAACAACTGTCCATGGACCCGACTCCGATTCCGAAAGC
TGCCGCTGCAGCGAGACTGTCACGGTGCCCCAGCACTTCCAGACGTCGCCACAGCTGTTTGCCGGCCCTACGGCGACGGG
AAAACCGGCATTTCTGGCGCAGACTGTGACCATCAACCCGTCCGCGACATACGTGGCCAACCAGCCGCTACAGACCAACA
TCGCCGTCGATGGCCAGCCGGCAGACGGCCAGTCAATCTTTGAGAACATGGGGTGGGTTTCCTATCATCCGCCGTGATGT
CGCTTGCTTTCGCGCTCCTCTGACAGGCCCTGCTAGATACCTCTCCCCCTACAAGCCCTCCCCGGGTTTTGGCGTGCAGG
AATACGCTCTCCCGCCCGGTGCAGAGATCGTGCAAGTACAGGTGAGCACTAAGAACCTTTTTGAGAACAGCTGGTGCCCT
ATCGGAAAGCTTACTGGCAACTCAGATGCTCTCCCGACATGGATCGCGATACCCGACGCTTGGTGCCAGCGTCTACGACC
TGGGGCAGAAACTAGCCAAGTCCAAAGGACAATTCAAGGCATCCAGTGCTCTCAGCTTCCTCGAAGACTGGGAATATAAG
ATGGGTCATGAGATCCTCGTTCCGAAAGGTGCTTTCTACACCTTTCTGATACGCCCCCAGAAATCAGCTTCTGTCATGCT
AACTCGCTTTAGGACGACAAGAACTCTTCGACTCGGGTCGGTCTTATACGCCAAATAAAACTGGAGCCTGAAATACAGTA
CTGACACTCGACTTAGGCATCGTTCACTCTTACATGTACTCCAACCTCTACAATCCGAATAGCAAGATCATTGTCCGCAC
TACAGTACGTTCTGCCTTGATTTACAATTCTCTTATCGCTCCTCTCTCTGACACACAAAGACCCAAGATCGTATGCTCAA
ATCTGCCGAGAACTTCCTCGCTGGGTTTTTTGGCCTCGAGTGGTGGGTTCCCTGTCCATCAGCCAGTTCACCAGTTCTCC
CCGCTCATCGTATCTTAGGACCAACAATGCCACAATTGAGGTGATCATCGAGCAGGACAGGGCCAACAATTCTCTTGCTG
GTTATCTGAACTGCCCCAACTCCTACCAGGACCACACTGGCACCGATGCCAACAATATATGGGTGGAGAACTACCTACGG
AATGGTGAGCCAGCACTTCTGGGAGAAGATGGGTTGGTCTGGTCTTTTTGCTTACATTCTATAGCCACGGCGCGCTTCCG
ATCTATGCTCGACGGAATCGAATGGACCATCAAGGACACGTACGCCGCACAAACTCTGTGCCCCTACGAGACTGTAAGTG
CCCTTTCGAGCTACTCTCCGCTTGTCTTGGCCCTACTCTGACACCCAAAATCTAGGCTGCATACGGCTTCAGTCGGTTTT
GCGACCTCTTCACATACGAAGAGTGGCTTGGGTTTGGCTACTCCATCGACTTGTCGTTTGCTGGTAACAACGGTTTTCAA
TCTTCTACAGGGGTAAGTCAGCAATACCCTGATGAGATATGGCAAAAGAGCGATGCCGAGAGACGTGCTAACAGGGATTT
TCCAGAGAGCCGTCGGCATTGGCTACCAGCAAGAGGTCATTGCACGCCTCAAGAATCATACGCTCGGCTACTCGGGATCC
CAGATCAACGTCACTCTCGACAACAACACCGACACTTTCCCGCTGAACCAGAGCCTCTACTTTGACTTCTCTCACGACAC
AAACATCGTCTCCATCCTGACTGCCTTTGGCTTCCAGCAGTTTGCGACCCTGTTGCAGCCGGCTGCGTATCCGGGCCAGC
ACAACTTCACCGTCTCACACATCGTGCCCTTTGGTGCCCGTCTCGACATTGAGATAATCAGCGCCCCGCGCCCAGTGGCA
GCCGATCGGTCCGGATACGAGGATGGTGTCAGCAACCGCGAGACCAAGTATATCCACTTCATCCTCAACCAGCGTACGCT
GCCGCTGGGCTTCAGCTTCCCCGAGTGCGATGCCTCACGAGTGGACGGCTGGTGTGAGCTGGATACCTTTTTGCGCGTCC
AGGAGGCCATGCCGGCACGAGCAAAGTACGACGAGGCTTGCTTTGGGCCGTTTACGTCGCGGCCGTATGGCATGGTCATG
GACGGGGCGCCGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62