GenePrediction:GLEAN_2503 Details

Name: GLEAN_2503
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1545070..1547132 (+ strand)
Length: 2063
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1545070..1545650 (+ strand)
Length: 581
Type: CDS
Source: GLEAN
Position: GCSC_140:1545706..1546087 (+ strand)
Length: 382
Type: CDS
Source: GLEAN
Position: GCSC_140:1546155..1547132 (+ strand)
Length: 978
>GLEAN_2503 class=GenePrediction position=GCSC_140:1545070..1547132 (+ strand)
ATGTCGATCCAAAAGCCCACCGATCTTGAGCGAGATCGTCGCCCTCGGAAGGCCCCGCCTCGTACAGGTGGCGTCCAAAG
TGTAAGCAGCACAGCTGGCAGCACCATCGGCATGTCCACTTATGCTGTTCGAGAAGCACCACTGGGGTCTGCTAGGCGCA
TTCGTGTCGTTGGCATTGGTGCTGGCCCTAGTGGCATCAACATGACTCGCAGACTGCGACTGCAGCTGGACAACTATGAG
CATGTCATCTATGAGAAGAACTCTGATGTGGGTGGAAGCTGGTACGAGTCAAGATATCCGGGCTGTCGTTGTGACATCCC
AAGCCACAACTACCAGTTTTCCTGGCGACCCAAGAAGGACTGGGCCAGCTTTTTTGCCGCGGCTGAAGACATTGGCGCCT
ATCTGGGCCGCGTCTGCGACGAAGAACACATGCGGGACATTATCAAGACTGAGCACCGGGTGGCAGCCGCCACTTGGGAC
GAGACCCGAGGCGTGTGGCTCCTCACCATCGAGAACATACGTACCGGCAAACAATTTGACGATTATGCCCACTTTCTCAT
CGATACATCGGGTATCTTGAAGTGTGTATCCCTGTCGTTCTTTGCCGTTTTGGGGGACACTCGCTAACGCAAGTAGCAAA
TGGAAATGGCCCGACATCGAAGGGCTCAACAGCTTCCGAGGAGATCTTATCCACAGTGCTCGATGGCCGGCTGAGTTCGA
ATACAAGGACAAGGTCGTGGCCGTCATAGGAAACGGCTCGTCGGGCATCCAGATCGTGCCCGCCATACAGCCTGCCGTCA
AACAGCTGGTCCACATTGTGCGCACGCCTGCGTGGATTGTCCCTCCACATGTCCAGGTTTTCTCCATGGGCGAGGCTGGC
CAAGTGCTCCGGGACATCGGCCTGGATGAAGAAGAGAACTTTGCGCCGAGTCAGATCGAGCGCTTCAAGAACGACCCGGC
CTTCTATCGAAAGTTTGTCAAGGGCATCGAAAAGGAGGTGAATAACACATTTCCCATCGTAAGTGGCCGATCACCCCTCA
TAGCCGTCTTGTCTGCCCATGCATCATCATGCTTACCGGCACTAGATTCTGAAAGACGGCCCGACACAGGCTTATGCACA
GCAACAAGTGCGAGCATACATGACAGCCATGCTGGGCGGCGACGAGAAGCTCTGCGAGGCTCTAATACCAGACTATCCCC
TTGGCTGCAAGCGGTTGACTCCTGCCCCAGCATACCTGCAGAGTCTCACTCAGCCGAATGTCAAGGTCGTCACTGAGGGT
GTGCGACGCATTGTGCCAGACGGAATCGAGCTGCTTTCTGGGGAGGTACTGAAATTGGATGCCATTGTCTGTGCCACTGG
CTACGACGTTTCTTTCTGCCCACGATTTCCTCTGCATGGTCGCAATGGCAACCTGCAGGCCCTGTGGCGCGAGAACATCC
CTCAAGCCTACATGTCCTGCTCCATACCAGGGGTGCCCAACTATTTCAGTGAGCTCCTCCCAAGAGATGCCATCCACGCC
ATGTTTCTGACAAGCCCACTTGCAGCATTCCTCGGCCCCAATGCCCCCATCGGCCACGGCAGCACCTTCACGCTCGGCGA
ACATATTGCCAAGTACGTCGCCCGTGTGATTCACAAGTGCCAGACCGAGGGTATCAAAGCAATTTCTCCGTCGCAGTCTG
CCGTAGACGACTACAACGAACACATACGCGCCTTCATGCCGCGAACATCGTGGTCCTCTTCGTGTCGATCTTGGTACAAA
CGAGGTCACGATGAGCCTGACGGGTTGGTCACTGCGCTGCATCCAGGCAGCCGCATACACTTCTTCCACATGCTTGAAGA
CTTCCGCGGCGAGGATTTTGACTATGTGTATGTCACGGATGCGGAAGAAGATGGGAAGCCTAGTCGTAGCAACCGTTTCC
GCTATCTCGGAAATGGCTTTTCGACCAAGGAGCTCGACCCGACATTCGATACCACTTGGTATCTCGACAATCCCGCGTTG
TCAGGTGTTGAGCCCCCGCCCAGAGCGGCGCCAGGCAGGGCGCTGATACTGTCAAAACTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62