GenePrediction:GLEAN_2504 Details

Name: GLEAN_2504
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1547477..1549942 (+ strand)
Length: 2466
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1547477..1547515 (+ strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_140:1547591..1549942 (+ strand)
Length: 2352
>GLEAN_2504 class=GenePrediction position=GCSC_140:1547477..1549942 (+ strand)
ATGGCTTCGGATCCGAGCTATAACGTCCATCCGGACCTGGTAAGTTGGCCGTTCAGGGGGGGCCACAGTTAGCTGAACAC
ACATCGACGGCTGTTGCTGACATCGTGCGGTAAGCTCCCACACATCCATCTGATCAGCGCGTATCGATACCCGCTGGTGC
CACGATTTGGCATTCCCGAAGTGACGGAATGGCTGCTCAATGCGCCCCGGATTGCCCGCGACGGGGCGCCATTTTTTTGG
ACCTATCTGGACATACCTCAGGATGGGACTATCATCCTGACGTGGCAGCCGTTGCAGCGACTAGGAATGGAGTTTGCATC
GGACGGCTATGTCTGGCCGCGCGGCGAGACCTACTACCAGCATGAGATTCGGGATGGCCTAGTACGTGAAGAGAAAGAGA
GAGACAGAGAAGACCGGGTGGACAACAAGCTAATCGTGCAGATTCTCGAGGTGTTTCACCAGCCGGTAGGGTATCGTCCC
GGCGAGGAATACGCAACACACTCGCGACGACGGTTCCGCCTGATGCCACCCAAAGTGCCGAATCCCAACACTCCTCAAGT
CGACCCAAGCTTGTGGCTGGTGCATTACGGCCCCATCGACGAGCGCGAGCCAATCCCGGTCAAGAAGATCCGGCTGGAGC
CGAGGATACGCACGGCGATGGAGACACGCAACAACCTGCAAAGGGCGGGGCAGATCACACGCAAGGAGTTTATGCTCTCG
GACCGGGTCAACTGGCCGCACATTCCGCTGCCTCGCGATGCTCGCGGACCACCGATGTACCCCGGCGTACCTGTCAGCGG
CCACCACATTCCGCAGCAGATGGCATACCCCCCACACGCGCCGGGCAACATGGCAGTGCCGCCACCGTCAAAGCGGGCGC
GCCATGTGGCTTCGGGGCCGGGACCCGGGGTTGTGCATCCTGGGGTCGGGCTGATGGGCGGACAACCGGGCATGGGCGGA
GCCCATCCGATGATGCAGCAGATGGATGTGGCGATCTATGACGACGAGGAGGACACGTCGCGTGGCGACATGTTTGATAA
TATTACACCGCGCGACGTGAGCCTCGAGCGGTACAAGCAGAACCACGAGTGGATGGAGGAGGTGATCTCATCGCCGTACC
GCATCAACCAGATTGGGTATGCTGACCTGGGTCTGGGTCTCAAGGGCGAGCTAGCCCCGGTGACGGAGGGCATCTTTGAG
GGTCAGGGCTTTGAGGCGTCCCAGCGTGTGCCCAAGAAGCCGTACGTCGGACGTCTGGACCCGGGCCTGGCAGATGAGTT
CCGCAAGCGGGTGACGGAACAAATGGCGGCGGCGCAGGCAGAGATCGCCGAGATGAAGGCGCAGCACGAGAAAACCGTGG
CCGACTTCCGGTTGAACTCGGTGGTCAAGGCGGCCGAGCACGATCTGCGCTTCTCGCTGGTGGCGAAGGATCCGAACGGA
CCGGAGGCCAGCTGGGGACTGGAAAGGCGGCTGGACGAGTCGGACGACGGGGACGAGGTCGGCGGCGACGGCGGCGGCGA
CAGCGGGCGCTGGGCACACCAGAAGCACCGCAAGACAGTGGACGAGATCATGGCCCATGTGGAAACGTCTTTGGGCCATC
GGATTGTGCGGACGGGCGCGGTGGTGCGAATCCAGGACGGCGGCTATCAGGAGCCGGAGCCAGAACCGGAACCGGAGCCA
GAGCCGACGGCAGAGTCAGAGACGTTGCTGGAAGTGCCGGCAGCTTCGGCGATGGTCGGTGGTGGCGCTGCAGCCGGAGC
ATCGCCCGCGGGCTCGCAGATTAGCGGCATCATGATTGGCGATGGCGACATGGACATGGGCGACACGGCGGCCGGGCTGC
TAGACCAGATGGAGTCAGCCTTCTCGGCGGCCTCAACACCCAGCAACAACTTCTCGACGCCGCACGGTCAGCTCCCGACG
ACGGGCCTGTCGAACGTGGCCACGCCAGGCAACGGGGCAGCCGGAGGGCCCTCAAGTGGAGGCGCGATAATGAGCGATGT
GACCATGCAGAATGCAAGTCATGCAGCAGCAGTAGCAGCAGCAACAGCAGCAGCAGCGGGACCTACAACGGCGGGCAACG
AAGATTGGGTGGTTGTTCCGTCCGGAGGCGATATCTCACCGGCTGGCGATGGTGCAGGCACGGCGACAGGAGCAGCCGTT
GGTGCAGGGCCTGCAGCAGGAGCAGGAGCAGGAGCAGCAGCAACTATCGTAGAAGGGATACCAGCAGCAGCAGCAGCAGC
AACGCCAGCAGGAAGCGGCATCAGGCCCGAGTCGGAGGTAGTGACTCCAGGCGGACTGCTGGAGGGCAGCGACAACAACA
CGAACAACGACTTTGGGTCGCTGGAGGATCTGGACACCGCAGGAGAGGCGCTGGCCGGACTGGAGGACGCGGCAGATCTC
GGAGAGGGCCTGGACCTGGACATGGAGGACTCTGCGTTTGGAAATGCCTTTGCCGGAGAGGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62