GenePrediction:GLEAN_2508 Details

Name: GLEAN_2508
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1564108..1566093 (+ strand)
Length: 1986
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1564108..1564153 (+ strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_140:1564216..1565908 (+ strand)
Length: 1693
Type: CDS
Source: GLEAN
Position: GCSC_140:1565967..1566093 (+ strand)
Length: 127
>GLEAN_2508 class=GenePrediction position=GCSC_140:1564108..1566093 (+ strand)
ATGGCACCACCAAAACGAAACAGCAGCTCCAAGCCGATCCCCAAGGGTAAGCCGCCACCTCTTCATACTTTGCAGTTGTG
TCGCTTTCGATCTGACGGTCCTGTTTAGGATACGCCGAGGACAACTCAAAGGGTCCGATGCTGCGGTTCCAAGAATCGCT
GCCGCGGCTGCCCGTGCCGACGCTCGAGGAGACGGCTGCTCGCTACGTCAAGTCGCTGCGGGCGCTCTACCCAACCGAAG
ACGTAGCTAAGAGCGAGGCTGCGGTGGCAGAGTTCATCCGACCAGGCGGCGTGGGCCAGCGATTGCAGGCCAAGCTGGTG
GCTCAGCGCGACGACGCCAGCGTGAAGAATTGGCTGTCGGAGTGGTGGAACGACGCGGCCTATCTGGCATACCGCGATCC
CGTGGTGCCGTACGTGTCGTATTTTTACTCACATCGCGATGATCGTCGCCGTCGCGATCCAGCCAAGCGGGCGGCAGCGG
TCACGACGGCCGCGCTCGCGTTCAAGAAGCTCGTCGACTCGGGCACGCTCGAGCCTGAGTACATGAAGGGGCTGCCAGTC
TGCATGGACAGCTACAAGTGGATGTTCAACTGTGACCGGATTCCAGCGCGGCCCAAGGACTACGCAGAGAAGCACGAGGC
GGCGACGAACAAGCACATTATCGTGGCACGCAAGAACCGCTTCTACAAGGTGGTGCACGAGGCGGGCGGCCGCACGCTGA
ACGCCAGCGAACTCGAGGCGCAATTCCGTCGTGTCTACGAGCTGGCCAGCGGGGCGTCGGGTCCAGCGCCACCGGTCGGC
TTCCTGACGTCAGAGAATCGCGACGTCTGGACGGATGTGCGGACAGCTCTGGCGGCAGCGAGCCCGGTCAACGCCGAGGC
GCTTTCAACAATTGACTCGGCGGCCTTCCTCGTCTGCCTCGACGATGCGGCACCGGTCACGCTGGAGGAGCGGGCACACC
AATACTGGCACGGTGACGGGTCGAACCGCTGGTTTGACAAGCCGCTGCAGTTCATCGTCAACGACAACGGCACGGCCGGC
TTTATCGGCGAGCACAGCATGATGGACGGCACGCCGACACACCGTCTCAACGACTGGGTATGCGATGCGATCTTCAACAA
CAAGCTGGACGCGCTCAACGATCCGCACGTGCGCGCCGACCTGCCCGAGCCGGTGGCGGTGGACTTCCGGCTGACGGAGC
CGCTGACGGCGGCGATTGCAGCAGCCGGCGAGCACTTTGCCGACGTGATCGGGCGCCACGAGCTGGCCGTGCAGGCGTAC
CAGGGCTACGGCAAGGGCCTGATCAAGAAGTTCCGCTGCTCGCCCGACGCGTATGTGCAGATGGTCATCCAGCTGGCCTA
CTTCAAGATGTACGGCAAGAACCGACCGACGTACGAATCGGCAACGACGCGTCGCTTCCAGCTCGGTCGCACCGAGACGT
GTCGTTCTGTGTCGGAGGAGTCGGTGGCCTTTTGCCGCGCCATGGCCGGTCCTGGCAGTGATGCCGACAGCGTCGATGCG
GCCACGCGCCAGAAGCTGTTCCGTGCGGCCATTGACGCGCACCTGGAGTACATTGCGGCGGCATCGGATGGCAAGGGTGT
CGATAGGCATCTCTTTGGGCTGCGCAAGCTGCTGGAGCCCGGCGAAGAAGTGCCGGCCATCTACGCGGACCCGGCGTATG
CATACTCGAGCAAGTGGTTCCTGTCGACGAGTCAGCTGAGCTCCGAGTTCTTCAACGGCTACGGGTGGAGCCAAGTCGTC
GACGAGGGCTTTGGCATTGCTTACATGATCAACGAGAACAGGTGAGTTGGCGTGATTGTGCTATGCTGTTCTGCTCATTG
GCTAACTGCTGCCTCACAGCCTTAACTTTAACATCGTGTCCAAGGGCCTGGGAAGCACCCGGATGAGCTTCTACCTGAAC
GAGGCCGCTGGCGACATTCGCGACCTGCTACTGCCGACGCTGGAAACGGCCAAGGCGAAGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62