GenePrediction:GLEAN_2509 Details

Name: GLEAN_2509
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1568638..1570187 (+ strand)
Length: 1550
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1568638..1568761 (+ strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_140:1568833..1569524 (+ strand)
Length: 692
Type: CDS
Source: GLEAN
Position: GCSC_140:1569744..1570187 (+ strand)
Length: 444
>GLEAN_2509 class=GenePrediction position=GCSC_140:1568638..1570187 (+ strand)
ATGGAGCATCGACAGCCATCTGATACGGCAGAAGAGCAGAGAACGAGCGAGGAGGTCGAAGAGGTCGAGGACAATGTCAC
GGATGCAGCCGTGGACTTTGTGTCGCTGGGCATGTTGATCATAGGTGTGTCTCGCATGCTTGCTTCGTCCTTCATGCGTC
CCTCACACGCCTTCTGCCTTCGCTCACACGTCCAGACGACATTGAGTATCTCCCGCCACGGCCGCCGGTGCGCGACGTTC
TCGGCGGTGCGGGTGCCTACGCGGCTCTGGGTGCGCGGCTCTTCTCGCCGGCGCCGCGGCTGTCGCGTTCGATCGGCTGG
GTGGTCGACCAGGGGTCTGACTTTCCGGCCGCGATGCGCGCCCAGATCGACGGCTGGCAGACGGCCGTGGTGCTGCGCGA
AGATGCCGGCCGGCTGACGACGCGCGGCTGGAACGGCTACGACGTCGGCGAGCGCCGCGCCTTCCGCTACACCACGCCCA
AGGTACGGCTAACGGCGGCCGACCTGCCGCCGCCGCTGCTGCGTGCCCGCTCCGTCCACATTGTCAGCTCGGCCGGGCGC
TGTCGCGAACTGGTGGCCGACCTGTTGACCAGGCGGCGCCAGCTCAAGGCGTCCGGTGCCCGTCCCTACATCGTCTGGGA
ACCGGTCCCCGATCGGTGCTCGCCCGACGAGCTGCTCGACTGCACCAACACCCTCCCGGTCGTCGACGTCTGCAGCCCGA
ATCATGCCGAGCTGGCCGCCTACATGGGCGACCCCGACGGCGGCCTCGATCCTGCGTCTGGTCGGCCGTCTGCTGCCGCT
GTCGAGCGCGCCTGCGAACAGCTTCTGGCCGCTATGCCGCTGCAGTCGTACGCCATCGTCGTGCGGGCCGCCGAGCTCGG
CTGCTACGTGGCCAAGAATGGTGGCCGGCGCCGACGCAACCGGCAGGAGAGGAGGGGAGAGAGAGAGAAAGAAAAGGAGA
AAGAGAAAGACAAGGAGAAGGAGAAGGAGAATGGGAGAGACAAAGAGCAGGAACCCAAACAACATCCCCAGCTGTCCCTT
CTCTCCGTCCGACTGCAAGAGACACAAGACACACATACAACACAGCAGTCTGGTCCACCCCCTCAGAACCTCCATGGCGG
CTTGCGTCCCGATATCGATATGGAGGCCCTGTTTGCCGGCCTGCAGCAGGACGACGAGGGCGCCATCGCCCGCGAGGAGA
TCGAGGTCGATCCCGGTCTCGAGATCTGGGTGCCGGCCGTCTTTGGAACGAGCGACAAGGACGACGACGATAACACCCCC
AGAACAAGTCCTGTCGTCGATCCGACCGGTGGTGGCAACGCCTTCATGGGCGCCATGGCCCTCGCGCTCGCCCGCGGCCA
CGGCCTCGAGCAGGCGGCCGTCTGGGGCAACGTGGCCGCTAGCTTTGCCATCCAGCAGGTCGGCGTCGCCGTCTTGGGCC
GCGACCCCGACGGCCGTGAGACCTGGAACGGCGAGCGCGTCGACGATCGCTGCACCGCCTACGAGACGCGTCTGCGCCAA
AACGGACTGCTGCGAGGGGATCGCCGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62