GenePrediction:GLEAN_250 Details

Name: GLEAN_250
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:533749..534839 (+ strand)
Length: 1091
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:533749..534620 (+ strand)
Length: 872
Type: CDS
Source: GLEAN
Position: GCSC_167:534683..534839 (+ strand)
Length: 157
>GLEAN_250 class=GenePrediction position=GCSC_167:533749..534839 (+ strand)
ATGGCTACTATGGAAACTCCAGCCGCCACAGCGACACCGGCACCGACGAATGCCGACGGGGCCGAGTCGACTGACCTCAG
CCGGCAATACGATACACAGTTGGGCCTGGCACACACCACAATTGAGGCGCTCAAGGCGCGCATCAAGCAGCACTACGACC
TGGCCAGCGACTACTATGTCAGCCTGTGGGGCGAGCACATCCATCACGGCTACTGGCCGACCGATGAGTCCAAGGCCAGC
GAGAGCAAGGAGACGGCGCAGGCGAACCTGATCCGCCTGCTTCTCTCCATCTCAGGTGTGGGTGATAGCAGCAGTGCCGC
CCTCGACGTCCTCGACGTCGGCTGTGGCGTTGGCGGCACGTCGCGCTGTCTGGCCTCGGATCTGGGCTGCCGCGTGACGG
GCATCACCATCTCGACGCGGCAGGTTGAGATCGCCAAGCGCCTGTCTGCAGGCACCACTGCTGGCGACGACGACAATGAC
GACGACTTTCAGCCCGTAGGCAAGGGCCACGTGCGCTTCCTCGAGCTCGACGCCGAGAAGATGGGCGACTACTTCCTGGA
CGGGACTGCGGACACGGGCCTCTTTGACGTCGTCTGGATCAGCGAGGCCCTCAGCCACTTTCCTGACAAGGCCCTCTTCT
TCCGCAATGCCCAGCGCGTGCTGCGACCCGGCGGCAAGCTCGTGCTCGCCGACTGGTTCAAGGCCGAGGGCCTGTCCGCC
AAGGCCTTTGACACTGACATCAAGCCGATCGAGGACGGCATGCTGCTACCACCGCTGTGCACGCAGTCCGACTACGTGAC
ACTAGCCACGGGCGCTGGCCTGCGCGTGCATGCACCGCCCAAGGACATCAGTGCCGACGTGAGCAAGACCTGGTAAGTAG
AGCGCGCAGAGGACAGGTCTGTACATACATGCTGATGCGAAGTTTCGCAAAAAGGGACCTCTCCTGGGATCTGGTGCAGA
AACCCTCGCTGTGGGCGTTTGCCCTGAGCCAGGGCCGCGACGGCATCGCCTTTCTGCAGGCCTTCCGGGCCATGCGACGG
GGCTACGGCAACGGCTCGTTTCGATATGCGGTCATGTGCTTTGAGAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62