GenePrediction:GLEAN_2510 Details

Name: GLEAN_2510
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1574080..1577977 (+ strand)
Length: 3898
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1574080..1574790 (+ strand)
Length: 711
Type: CDS
Source: GLEAN
Position: GCSC_140:1574852..1575105 (+ strand)
Length: 254
Type: CDS
Source: GLEAN
Position: GCSC_140:1575152..1575560 (+ strand)
Length: 409
Type: CDS
Source: GLEAN
Position: GCSC_140:1575839..1577178 (+ strand)
Length: 1340
Type: CDS
Source: GLEAN
Position: GCSC_140:1577287..1577977 (+ strand)
Length: 691
>GLEAN_2510 class=GenePrediction position=GCSC_140:1574080..1577977 (+ strand)
ATGGTTGATCTAGACCAGCAGCAGCAGCCTCCTGCCGGGGCGAATGCCGGCTACAACTCAGCCGTTCTGCACCGCCAGCT
GCACCATAGCTTCCCCTGTGTTGTGCAGGGATCCGGCAGCCGGCTCGTGCTAGACGACGGCCGGTCCATCCTCGACGCAT
CGGGCGGCGCGGCCGTCGCCTGCATCGGCCACGGGGACCGCCGCGTGGTCGAGGCGGCCATGGCGCAGATGTCGCAGATC
GCCTACTGTGCCACCACCTTTTATACAACCGCCGCGTGTGAGCAGCTGTGCCGCTTCCTGGTCGACTCAACCGACGGCCA
CATGGCGCGCGCATACATTGTCAGCTCCGGGTCCGAGGCCATGGAGGCGGCCATGAAGCTGGCGCGACAGTACTTTCTCG
AGAAACAGAAACCCGAGCCCGACCGCTTCCGTTTCATCGCCCGCCACCAGTCGTATCACGGCATCACGCTCGGTTCGCTC
TCCGTGGGCGGCCATCCGTTCCGGCGCAGGAAGTTTGAGCCGCTGCTGCTGCCGGGCGTCTCGCACGTGCTGCCCTGCTT
CGCGTACCGTGGCAAGCTGGGAGCGGCCAGCCAGGACGAGGAGTCGGACGAGGCTTACGTCGCCCGGCTGGCGGCCGAAC
TCGACGCCGAGTTCCAGCGGGTCGGTCCCCACACCGTCTGCGCTTTTGTAGCCGAGCCGGTCGTCGGCGCTGTACGTGTC
CCTATTGCGTTTTCTCTCCCTGGCTCTTCCAGACTGACCGGTGTCGCGACAGGCTCTCGGTGCCGTCCCAGCTGTGCCCG
GGTATTTCAAGGCTGTCCGGGATGTGTGCCACAAGTACGGCGCGCTGCTCATCTTGGACGAGGTGATGTGTGGCATGGGC
CGCACGGGCACGTTGCATGCCTGGCAGCAGGAAGACGTGGTGCCTGACATCCAGACGATGGGCAAGTGCCTGGGGGGAGG
GTATCAGCCCATTGCAGCCGTTCTCGCCAGCCACGAGGTCACCGATGCCTTCAGCCGAGGCACAGGGTACGTACTGCTCT
CAAGAGGCCGGTAAACCTGCTAACGTTTCCAGATCGTTTGTCCATGGGCACACATATCAGGGACACCCTGTTGCCTGTGC
AGCCGCCCTGGCCGTCCAGAAGATTGTCGCCGAGGAGGATCTGCTCGCCAACGTGCGCGATTTGGGAGCTGTCCTGGGAA
GGCTGCTGGTGCAGCGACTCGGCAGCCATGCGAACGTGGGAAACATTCGCGGCCGAGGCTTCTTCTGGGGCATTGAGTTC
GTGCAGGACAAGGCCACAGCCCGCCCGTTTCCAGCAGAGAGCCAGGTGGCCATGAAGATAGCCGAGCTAGGCCTCAGCGC
ACAGCACGGTATCGCGGTCTACCCGGGATCGGGCACAGCGGATGGCGTCTCGGGAGACCACATCATTCTCGCGCCGCCAT
ATAATGTGACCCGTGCAGAAGTCGATGAGATCGGTGACAAAGTGTGTCGGCTGGTTACAGAGTACTTTGCGAGGAACGAG
CTGTAGCTACTATTATGTAGAGTGGAGAATAGAGCTATCACGTCCGGGTCTCGGAGCTAGTGAAATTCCGGCTTAGCCAG
TATTCATGGCAGCCTACAGTGGGTCACCCCTGCTGCAGCAACGACAAGGACGACGGTTTGGAACTCGTCTCCCCACTGCC
GTCATCAACCAAGACGCTGACGGGGCGCGGCCTGATTATCCGATAGAGGGCCTCCAACTATCGACATCTGCGCGCACAGC
CGATCGCACGAATGGCTGTCGGACTGACGGCAAGCGGCACCAGCGCCAGCCTGAGCCGCCATGCAGCCGAAGAGGAAGCG
CGTGCCGAAGTCGACGTGCTCAACTCGCGGCTGGAGAGGACATCGCAGCTGACGAGAAAGATTGAGACGTGTCTGAACCG
GCTGGATGCGACGGGCAAGCGAGTGCACGAAGTTGCAGGGCCGCTTAACGGCGAGACCAAGCGGCTGCAGGTTCTAGGAC
ACAACATCGACAACGTGATCGCAGCGATTGCGCGGGTGCGTCAGCCGGCCGACAGCAAGAACGACGAGGAGCAGATCATT
CGGACAGGACCAGAAAATGCCGGACTGCCAGCGTACCTGTCGTCGATCCAGCGGCTAGAGCGGTCGCTCGGTGACATGAA
AGCATCAAACATCCGGTCGACACAGCAGACGATTGGCGAGCTACAGCGACTGATCCGGTCAGCCAACTCGCAGCTGGAGC
TGTACTTTGACAAGCTGCTGCGAGCCGAGACGCCACGCGAGATCGAGCCGCTATTTTACGTGACGAAGAACAAGCCGTTC
CCGGTGCTCTCACAGGACCTGACAGCTCGGCTGGGACTGATCAACGCACACGTGGCGGCAGCATACCGACAATCCAGCGG
GACAACAGGAACAGCAGCATCAGGCGGCGGCGCTGGACCGGAGTCGCCGGTAGCCAAGATCTACGCAGAGGTGCGCGGGC
CGTACCTGGCGGGCACGCTCAAGAACCTGGCGTCAGCCAGCATCAACACGGCCAAGAAGAAGAACGCGGACGCGATGTAC
CGGCCAGGGACGAATGGGATCAGCACGTACACGCAGGCGATGGAGGGCATGTTCCTGTCCGAGTACGACAGCATCTGCAG
CGTGTTCACGCGCGAGGACTGGGGCCCAGTGTTCCAGGCGGCGTGCCAGCCCGCGCTGACAGAGCTGGCTCGCACGCTGC
GCGAACTGAACGGCCACATCAAGGCGCACCCGCAGACGGACTGCTACCTGGCCTATGAGATTGTGGAGATCGTGTCGAGC
CTGTCAGGGCAGCTAGAGACGCGCACGGGCGAGCTGAAGGCGTCGTTGGCGGCAGCGCTGAAGCCGGTGCGCGAGACGGC
CAAGGGATCGCTGGCCGAGCTTCTGGACGACGTGCGACGGCGAGCGGGCTCGATGCAGGCCCTGCCGCCCGACGGGGGCG
TGCTGCCGGTCGTGTCCGAGACCATGCAGCGGCTGCAGGTGATGACCGAGTTCCTGCGGCCGCTGTCGAGCATCATGATC
TCGCTGGGTGACGGTGGCTGGCGATACGGCGGCCTCGGCTCGACGACCACCCTGGCCTCGTCGCTGTCGACAGGATCGAC
AGGATCGACAGCAGCCGGGCCAGGAGCAGCAGCAGCAGCCGCAGCCGCCACGGCGGCGGCATCGGGCTCGTCCGAGGGGA
TCCCCAGCCTGGCGTCGTTTGACGTCAACGCGGACGGCCGCGACATCTTTGCACACTACTGCGCCGACACGGTGGACGCG
CTGCTGTCGGCGCTGGACGCGCGGGCGCGGGTGCTGCAGGGCCGCAAGCCGGTGGTGGGCGTGTTCCTGGCCAACAGCAT
CAGCGTGGTCGAGCGGATGGTGCGCGAGTCAGAGCTGGCCGCCGTGCTGCAGCCGCGGCTGGCCGGCGTCGTGGACCCGT
GGCGCAAGAAGGCCGCGACCGTGTATCTGGACGCGTGCAAGGACGTGTCGATGCACCTGTTTGACGTCATCCACACGAAC
CGCAGCGGTGGCAGCGGTGGTGGCGGCGGTGGTGGTGGCGGCGGCGGCAGCAGCGGCTCCGGACGGCCGCAGTCCGGTCA
AGGCTTCGTCGACTCGGCATCCGTGCTCAAGGGCCTCTCGTCCAAGGATCGCGAGAGCATCAAGGGCAAGTTCACCGCGT
TCAACGCCTCCTTTGACGAGCTGCTGGCACGCCACCGCCAGTTCACCATGGAACGCGAGGTGCGCCAGGCCTTTGCCCGC
AACATCCAGCAGATGCTGGAGCCGCTTTACAACCGCTTCTACGACCGGTACCACGACGTCGACAAGGGCCGCGGCAAGTA
CGTCAAGTACGACAAGGTCGCCATCTCGGCCGTCTTCACGAGCCTGTACCAGGGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62