GenePrediction:GLEAN_2511 Details

Name: GLEAN_2511
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1578253..1579301 (+ strand)
Length: 1049
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1578253..1578290 (+ strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_140:1578388..1578428 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_140:1578491..1578841 (+ strand)
Length: 351
Type: CDS
Source: GLEAN
Position: GCSC_140:1578904..1579301 (+ strand)
Length: 398
>GLEAN_2511 class=GenePrediction position=GCSC_140:1578253..1579301 (+ strand)
ATGGCTGACAACAAGCAAGCCCAAATCACGCTCCACTGGTACGTCTTCACCAGGTGTTGTCCCAGCCGATGAAACGGCAG
GCGAAGACCGATAGGGAACTGGACAAGAGAGTACGGCTTCCTGATACATGTCTAGGCTCGATGGCTCGCGCGCGCAGCGG
ATTCTCTGGCTTCTGAGTATGTCACATGGCAGCTTCTTGTCGGCGGGCCCTGTACATTGATCTGCTGACTCAGCATAGTT
GCCCTGGATGTGCCGTACGAGCTGAAGATCTACCACCGCATCAAGGGCGTGTACGCGCCGCCGACGTTACAAAAAATATT
TCCGCTAGGCAAGTCGCCGCTAGTGACAGTGCTGCCAGCGGGTGCGCCGGCTGACGCGGAGCCGCTGGTGCTGGCCGAGA
GTGGTTTCATCGTGGACTACCTATGCTCGCACTTTGGCCAAGAGAGCAACCTGGTGCCGAAGCGCTGGCGTGACGGCTGC
CAAGGCCAGCTCGGCGGCGAGACGGCAGCATACCTGCGCTTCCAGTACCTGATGTACTACGCTGAGGGCTCGCTGATGCC
GTATCTGGTGTTTTACCTGGTGCTGTCGAGTAGGTCTTCCGTCTGCCGTCCTTGTCTCCGTCCGCCCTCCGCTCACAGAG
ACGCTCTCCAGCCCTCAAGGGACCCACCGTTCCCTGGTTCGTGCGCCCCCTCACCAGCAGCATAGCCAACCAGATCAACA
GCGCCTTCCTGCTGCCCAACATCCGCAGCAACCTCCAGCTGATGGAGACGTTTCTGGTGCATCCGCCCGAGCCGGCCGAC
GGCCAGGGCTACATCTGCGGCGACCACCTGACGGCGGCCGACATCCTGCTGAGCTTCCCGCTGCTGGCGGCACGGTCGCG
CTGCCAGGATATGGGGCCGTGGAACGGCGGCTCGGCCGAGGCAGAGTTTCCCGTCACGTTTGCGTATCTGGACCGGCTGG
AGAGGGAGCCGGGGTATCAGAAGTCTATTGCGAAGATCGAGGAAGTGGATGGCAAGTTTTCGGTCTTGACAACGGCCAGG
GGACGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62