GenePrediction:GLEAN_2512 Details

Name: GLEAN_2512
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1579913..1582502 (+ strand)
Length: 2590
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1579913..1580813 (+ strand)
Length: 901
Type: CDS
Source: GLEAN
Position: GCSC_140:1580866..1582502 (+ strand)
Length: 1637
>GLEAN_2512 class=GenePrediction position=GCSC_140:1579913..1582502 (+ strand)
ATGCAGGACGCGGCCTCCAGCAGCGGCCAGCATGCATCTGCCTCCGAGACAACCACGGGCGATCTTGGCACTGCTTGTGG
TGTGGCAGCCATAGCGCCGCCGCCGCCGCTTGCCGCCGCCATCCGCCCTGGCACAGCCATGTCCACCTCCACCTCGTCGT
CGATGCCAAGCTCAGTAGACACCACCATGATTCCTAGTGGGGGACCTAGCGCTCCCGAGGCGTCCAGGACAGCCGGCGCG
ACCAGTGACGCCGACGAGGCTGCAACCGACACGGGCACGTCGGACGAGAGCATATATGGCGACCAGGATGACGCGCAGTC
CTTTATCCAGCCGACCATCAGCCCCATGGCCACGCGGCTGTCGTTGCCCCAGAAGCAGTCGCTGGCCGAGCGGGTCAATT
TCATGGCCGGTGGTGTCGGTGGTGATGGTACTAATGGTGGCTCCCCCAATCTGGCTTCACGCCGATCGCAGACTAGCCGG
ACGGCTCTGCTGCACGCAGCAGCACGACAGAACCGGTCCTCGTCCGTCGGCTCGGACGCGCTCAAGCGGCTGTCCAAGGC
ACTGCCGTCGCTCTCGTTCCCCAAGGGCTCCAGCACCTTCTTCCCCAGCCTGCCGACACCGTCCTTCTTGTCTGCCGTGA
CGTCGCCGACGTCGCCGGCATCCCGCAAGAGCCTGTCGACTGCCCAGAACCAACAACGGCAGCCGACAGTAGCCTCGCAG
CAGCCCTCGTCATACAGCCACCATCGGTCCACGTCAGATGACTCGATGCTCTACCAGACCCTCTCCCGGGTCTCCTCCCT
CGGCGACGACGACAACTTTGACAACATCCGCGAGCAGGTCAATTCACGCGTCAAGGCCATCATGGACAGCTTTCCCGACC
GGCCGACCTTCAAACTGCCGAGTAGGTCTGCTCTGTTTCCGTCTCTTTCCTCGCTCCTCTCTGACAAGTCTAGGCTTCTT
TCCGGATGGCAAGTCCAGCGCTGGGGCGTCTGCGCCGCGTGAGCCCGCATCGTCCCTGGACATCGCCCTCGAGTCGTTGA
CCGGTGACGTGGTCGTGATGGGAGGCTACCGCGGATCGATTCTGCGGTCGGCCGAGCCGCCACATCGACAGCTTTGGGTG
CCGGTCAAGGTCGGGCTCAACATCCGCAAGGTCAACATGGAGATCGGCCTGGACCGGGAGGACGAGCTGAACATGGACAA
GTCCATCTTTGCCTCAGGCATGCTGAAGAACATCGGGCCCGTCGACATTTCGCGCCGGCTGTTCAAAAAGCTGCGCGAGT
GCGAAAACGCCCGTCACGGCAAGTTGCGCGTCCACGACTACGGGTACGACTGGCGCCTCAGTCCACACCTGCTGTCGAAG
CGCCTTAACGACTTCTTGGAAACGCTGCCCAGCAACAAGCTGCCATTAGGCTCGGCCGGTCGCGGTGCCTTGGTCATCTC
CCACAGCCTCGGCGGCCTGATCACCCGTCACGCCGTCAACCAGCGGCCGGACCTCTACTCCGGCGTCATTTATGTCGGCA
CGCCCATGCGCTGCATCAACATCCTGGGACCTTTACGCAACGGCGATGCCGTCCTGCTCAATGAAAAGGTCTTGACTGCC
CAGGTCAATTTCTCGCTGCGCACCACCTTTGTCTTCCTGCCCGAGGACGGCTTCTGTTTCGTCAACACCAACGACCCGGA
CGAGGAGTACCGTGTCGACTACTACGATGTCCAGGAGTGGATCCGCTACCGTCTGTCGCCCTGCATCGGTCCGCCTGCCC
TACCACCTGCTCACCAGGACGGCAGCGGTGTTCTCAAGCGGAGCAGCACCATTGGTGCCCTGCTCGAGGATCTCTCCGGT
AGCCTGCCGTCATTACCGCTTCGGAACCGCATCAGCAGCGGCGGCATCCATGGCGAAGGCACTGCCGAACGCACCTTGGC
GCCCCAGATGAACAGTCTTGTCTCTCCGTCGTCATCGTCATCGTCACCGTCACCAGCTGCTTCCACTTTTGCCACTGCGA
CGACCACGGCCACCACGACGGCCACGCAAGCCACGCAGACACCCCCGCCTCCATCGCCACGGACCCATCACCGATCGCCG
TCCTACGATCCTGCGGCTGATACTCCTCAGCGCGCCCGCTCGCTGGCCTATCTCGAACGCACTCTGGCCGAGACGAAACG
CTTCCGAGCTGAGCTCGCCCACCGGCCCGAACACACTGTCGCCAACGGGTATCCGCCCACTGCTGTCATTTATGGCAAGG
GCATCCCCACCGTCTTCGCGGCTCGTGTGGCCAACCGCGAAAGCATTGCGCGCAGCGACGCGTTTGACGACCTCGTCTTC
CGCTCCGGCGACGGCGTCGTCCTGACCCGCGAGTCCATGGTTCCCGACGGCTACCACGTCGTGCGTGATGGCTACGTCAG
CTCCGACCGTGGCCACGTCAGCCTGCTGGGTGACCATGCCGCCGTCGGCCGCGCCATCGAGGCCGTCATCCGCGGCCGCA
CAAAGGGCATCGGCCTAGGCCTTTCCGCTGCAACGGCAGCAGCAGCTTCGGCCATGTCCCGAGAAGGAGCTGAACCAGTA
GCGATGATGGAAACAGGGGCATTTGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62