GenePrediction:GLEAN_2514 Details

Name: GLEAN_2514
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1588817..1590339 (+ strand)
Length: 1523
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1588817..1589404 (+ strand)
Length: 588
Type: CDS
Source: GLEAN
Position: GCSC_140:1589453..1589920 (+ strand)
Length: 468
Type: CDS
Source: GLEAN
Position: GCSC_140:1589986..1590339 (+ strand)
Length: 354
>GLEAN_2514 class=GenePrediction position=GCSC_140:1588817..1590339 (+ strand)
ATGGCGCCCGCCACCAAAGTCGAGCGGACAAGCCGTCCACGATCGCCATTGCGAGCTCCCACGCCTCTGGCTGTCTCTCA
TAACGGAACAAATGGCAGTGCAAAGCACGATGCGAAGAACGGCAGACTGGACAGCAACATGACTAGCGGAAGAAAGCATG
ATAGTCTCGCGAGCTACGAGAGCAACGGGAACCACGAGGATGCCGAGAACATCGACGACTACGAAAAACGTAAAGGCCCC
GAGAAGAGGTCCAGAAGGGGCTACGAGGGCGAGCCCAGGCCGTCGTCCCTTTCTGAGCGGACATTGCATCCGTCGCGAGC
GCCAACACCGTTGCTGGTCAAGGGCGACCACATCCTGCGTGACATCGACCGCGCTCCTCCTGGCGACCCGTCGCAGCTGC
GTGTCCGCCGCACGTCCGGTCTGGCATCTGCAGCTGGAGACAGAGGAGGCGGCAGTGATGACGTCGCACGCCAGCGCAGC
CAGTATTTTGAAGACGTCTTCTCGGCTCGGGACAGCAACTCGAGCCCGGCAAAGGAGCGTGTGCGGAGCGAGGCTCTGGT
CTTGGCAGAGCTGCGGACCAACGTAATGGTACGTCTGTATGGGCGGACTCCTCTTTCTCTCGCTTACTATTTGCAGATTG
GCGACGAATTTACTGTGATCACGGAGCTGTCAGCTAGCCTCGCCGTGCGGTATCGTCGGCCGCTCTCGTCCGTGGTGGTG
ACGCTGCAGCACAACTCGTGCATGTGCTTTGGCGGCTCGTTCGATCCGGCCTATGTTCTGTCCATCTTTGCCCTGCCGGC
CGAGCTGCAGCCGACGACGAACAAGCGCAACGCAGCCCTGATCCAGAGGCACATGGAGGAGGCTCTCGGCGTGCCACCGG
CACGTGGCCTTTTGCGCTTCGCGCCCGTTACCGAGGCCAACCTGGCGTACGGCGGCAAGACAACGGCCGGATACATCGAC
GACCTGCCCAAGAACACGGGAGCCGGCACTACCACTGCCAGCAACTACAGTTGCCGGTCCCCGGTCCTGTCAACGACTGC
TGATATGCACGATCTCGGTGGCAGCACGCGAAAGAGAAGGGCTAGCCGGAAGCTAAGTGTCAAGGTAAGGCATATTGGAA
GCCGGTTGTATCCTTCTCCTGCATCGGCATCGCTAACACTCTTGTCCAGTCTTTGTCTAATTTCAGATCTCCCTCGCCTC
CGAGTCCGACGCCGGTGGGCAGCACTGCCGAGGATCAGCAACAGCAGCAACAGCCGGATTCCTTGTCGTCAGCCTATCTG
CCATCTATCGTTGAGCGGTCACCTAAGGAGAGCCCACAATATAGGCAGAGAACAGAGAGGGAAAAGGAAAGGAGAGAGCA
CAAGGGTCCTTCTGGAGCGGATCAAGATACCGGTTTGGAGATGCTGCCGGAGACCAGTCCGTCGGCAACGTGGCAGCCCA
GCAGACGGGCTAAGAGAACCAAGAGTTTTGTGGCGACGCTTTTTGGACGATCAGCGATAAAGTACGAGATGGGGACCTCC
TAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62