GenePrediction:GLEAN_2515 Details

Name: GLEAN_2515
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1592670..1593881 (+ strand)
Length: 1212
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1592670..1592683 (+ strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_140:1592834..1592935 (+ strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_140:1593026..1593881 (+ strand)
Length: 856
>GLEAN_2515 class=GenePrediction position=GCSC_140:1592670..1593881 (+ strand)
ATGGGCCAGCGAGCGTAAGCACGGTACCTGTCCTTGTTAGCTGATTGAGCTCTTTGGGTGACTGGCGCGCCTGTGTTGGT
TGCCGACGCGCAAGCCGTATGGCTCGATGGACTCATTTAGTCGCCTGATTTTTGGATTCCGTATTAACCGACGGACTCGT
TTAGGAGCGGCAAGTCGTCCATATCGAGCGTGGTCTTTCACAAGCTTCCGCCTAATGAAACCCTGTTTCTCGAATCCACC
TCGCGTTTGCAGAAGGATTCTATGGCGTAAGTATATCCATTTCGGACCGTCCGCTGCAGAACGTGGTCTCCACACGAGAC
TGCGCTCTATCCCGTCGCCTGCTAAGTGCTCCATAGATCCTTCATGGACTTCCAAGTATGGGACTTTCCGGGCCAGATAG
ACTATTTGGAAGCCAGCAGCTTCGACCTCGATGCCATCTTCGGCGAGGTGGGCGCTTTGATATGGGTCATCGACTCACAA
GACGACTACCTCGAAGCTGTCGCCCGCCTGAACAACACCATTCTCATCGTTGAGCGAAATTACCCCAACATCAATGTCGA
GGTCTTCATCCACAAGGTCGACGGCCTATCCGATGATTTCAAGATGGAGATCCACCGAGACATTATGATCCGCGTGCAGG
ACGAACTCTCCGACCAGGGCTTTGAGAATGCCCCGGTCACCTTTCACCTGACGAGCATCTATGACCACAGCATTTTCGAG
GCCTTTAGCAAGGTCATCCAGAAGCTGATTCCACGCCTAGGCCAGCTCGAGGCCATGCTGACGTCGCTCTGCCGTACCTG
CCGCTTTGAAAAGGCCTATCTGTTCGACGTCCTCAGCAAGATCTACATTGCCACGGATAGCACCCCCGCGGATATGGCGT
CATATGAGGTCTGCTCCGACTTTATCGACGGCATCATCGACATCACAGAGGTGTACGGCAGCTGGGACCGGCCCGAAGCG
TACCACCAGCGCCTTGAGGCCACGCAGCATCAGCCTCTCGCCGACCAAATCGCTTGTCCCTGGGCAGAGAGCTGTATCGT
GCTGGCAGACGGCAGTAAACCGATTCTGCTTCGCGAAGTGGACAAGTATCTGGCCCTGGTGGCTGTCATGAAGGAGGGCT
CCTACGACAAGATCCCATTGATCAATATGAACGTCGACGTGGTGGTCAGGGGTCTGACTGAGTTTTTCCAAATCACCAAG
CAGAAGAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62