GenePrediction:GLEAN_2516 Details

Name: GLEAN_2516
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1597487..1597960 (+ strand)
Length: 474
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1597487..1597508 (+ strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_140:1597586..1597621 (+ strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_140:1597710..1597825 (+ strand)
Length: 116
Type: CDS
Source: GLEAN
Position: GCSC_140:1597907..1597960 (+ strand)
Length: 54
>GLEAN_2516 class=GenePrediction position=GCSC_140:1597487..1597960 (+ strand)
ATGGCCGGCCTTCAGCACTTCAGTACGAAACCACGACGCATGCCGTAAGAGGGCACGAAGGGCGAGAGGACTTTTGCTGA
CCAGACGATTTCTTTGCAGAGATGGACTTGGACCCATCGATCGTCAAGCTGTCCAGTATGTTTTCCCGTGGCTTTGACTC
TGCTGAGTTTTTCGCTGTCCAGGTCGACAGCATGATTTTCATCGCTGACTCCCGCGCAAACAGACATGACCAACAACCGG
TACAAGTACTTCCGGTGGACGCCACGGACAGCATGGCTCTCGTTCTTTTACATCGGACTGGTGCCGTCGCTTCTCGGTGT
CGTCGCATACAAGACAGAAGTCAGTATTATCCCCCGGCTCATTCTTGAAGTGGGCGAGACGGTTGCATATGTATGCTGAC
GTATGGTCTCGATAATGCAGGGCAAGTGGAATATGCGGGCGAAGCGGAGGGGCGACACGATCTCCGAGTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62