GenePrediction:GLEAN_2518 Details

Name: GLEAN_2518
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1604321..1606386 (+ strand)
Length: 2066
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1604321..1604412 (+ strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_140:1604480..1604544 (+ strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_140:1604612..1604738 (+ strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_140:1604811..1606112 (+ strand)
Length: 1302
Type: CDS
Source: GLEAN
Position: GCSC_140:1606182..1606386 (+ strand)
Length: 205
>GLEAN_2518 class=GenePrediction position=GCSC_140:1604321..1606386 (+ strand)
ATGGTTTTCGGTAGAAGAAAAAAGGGCGCTTCATCTGCGGCCAATGGACTCATTTCCCACGATCTGGTTTTCGTGGAAGA
GTTTGACGCGCTGTATGTGGCTGATTATACGTCGACGACGCGCCCATATTCCGAGATGACCATCTAATGCCCTTCGCAGG
TCAATTGAAGTGAAGCTGGGGACCGCGCTGGCCGCTCCCCACAATGCGAGTCTGAAGTTTCCCGGTTCGTCTTGAAACCG
ACATATCCTGTAGCAGAGACACATGTATGGTTGCTAATAGAAGTTGCTCAGCTAAGCTGCACGCCCGCAAGGTCGCAAAG
GAGCTGGGTATCGCTGAGGGCCTTATTTATCTTCCCGGACTGCCGTCCCTGGTATACGAGGACTCCGACATGGGACCCGC
GTTTCGACAGAGACGATAGTAAGGACAGCTTGGTCCATTGCCGATCTGGCTTTCCTCTTTGGTATCTTCACATGCTAACC
CGGCTTACAGCTTCTACTATCTCGGCGGCGTGGATTACGAGGACTGTGCCGTGACCTATGATCTGGCTAGCGACAACCTA
GTGCTTTGGGTGCCCTACATCGATCCGCGCCAGGTTCTGTGGTACGGCTCGGGCCCAAAAATAGAAGAGTGCAAACAGGC
TGTCGACATTGACGACGTCCGCTATGTGCAAGACCTGGATGGCTTTCTGCGCAAGCGGCTGGGTGTTTCCGGCTCCGGTA
TCGTCAGCGCATCTGTTGGCAGTAGCTTCTGCTGCGACAGGAAGGGCCTTCGCGTTGCCAACGCCGACTCTGCGCGGCCA
TCGCCAACAGTGCTGCTCGTTTTGCACCCAGATCAGGTGCCGGCGTGGCTGCGGCAGGATGTGAGCGGCTTCTCTTCTGT
TCGTGTAGACACTCGGAAGCTGCAGCCGGCCATGGATTCCGCACGTGTGGTCAAGACCGCATACGAGATTGCTCAGATCC
GCCAAGCCAACGACGTGAGCTCGTCGGCCCATCGCGAGGTGCTGCACCGGCTTAAGGGCCTTAGCAACGAGCGCGAGATC
GAGGCTGTCTTTCTCAATCACTGTCTGGCCGTCTACGGCGCCAAGCACCAGTCCTATGGTGTCATCGCCGGCTCGGGTGC
CAATGCTAGCGTGCTGCACTACTTCACCAACGATGAGCCGCTGGCGGGCCGCCAGCTCGTATGCCTCGACGCCGGTGCCG
AGTGGAAGCTGTATGCATCGGACGTTACCCGCACATTCCCCATCTCGGGCGTCTTCACTGCCGAGGCGGCCGCCATATAC
GCCGCTGTCGACCGCATGCAGACCGAGGTCATCGAGCAATTCCAGCCGGGTGTCGCCTTCCGGGACCTGCACCTTCATGC
CGCTAGTGTGGCCGCAGAGGAGCTGCTACGCCTCGGAATTCTCAAGAACGCAACTGTTCAGCAAATCGTCGCTGCCGGCA
CCATCGCTGCCTTCTTTCCCCACGGCCTCGGCCATCACGTCGGCCTCGAGGTCCACGATGTACTCTCGCCCGAACTTATG
GCGGCAGCACCCAAGGCAAGCGCCGCAGCTAGGGAGAGTCAGGAGATGGAAGCTCGCGCTGCTGCTGCCGCCTCTTCAAT
CCCGGCGCTGTCTTCATTGTCCGGCCGTGGTACCAATGCCCGCGGAAAGAGGCTACTTGTGACACCCCACATGTATGCCA
CACTCGCGCGCGACGCCGCCATCGAGGCCGAGAGAGCAGCAGTTATGTCGTCCGTACGGGAGAAACGGCGGCTGCTGGAA
CCGGGCATGATCATCACCGTGGAGCCAGGCATGTGAGTGGAAGAAGTCCCCTTCGTTTATTTCCTCCTGACGAGTCTTGA
CACTGACTTGAACGACCGCAGCTACTTCTGCCGTCCTTACATCGAGGCCTTCTTCCTGGCCGATCCATCGCACGCTCGCT
TCATCGACAAGGATGTCCTAGAGCGGTATTACGCGGTAGGAGGCGTGCGCATCGAGGACTGCCTACTAGTGACGGAGGAT
GGCCACGAAGATCTGACGACGGCACCTAAGGGTGAAGAAGCTCTGCGGATCATCAACAGCAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62