GenePrediction:GLEAN_2519 Details

Name: GLEAN_2519
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1609172..1610806 (+ strand)
Length: 1635
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1609172..1609251 (+ strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_140:1609319..1610091 (+ strand)
Length: 773
Type: CDS
Source: GLEAN
Position: GCSC_140:1610145..1610806 (+ strand)
Length: 662
>GLEAN_2519 class=GenePrediction position=GCSC_140:1609172..1610806 (+ strand)
ATGGCGGCAGAAGTATACCCGTCAATTGCGCAGTGCGCACTGGTAGCTGCAGCCTTCAAGATCCTCTTGTTCCCGGCATA
GTAAGTGTGACCGCCTGGCTCGTCAAGACACGACAACTCGGTCGGACCGGAATCTGACCTCTGGCAGCAAATCGACCGAC
TTTGAAGTCCACCGAAACTGGCTGGCCATCACCCACAGTCTGCCAATATGGGACTGGTACTACGAGAAAGCAACGTCGGA
ATGGACGCTCGACTACCCGCCCTTCTTTGCCTACTTTGAATGGATCATGTCCCAGGTGGCTGCCCTCGCCGACCCGTTGA
TGCTGCACGTCTACAACCTTAACTACGACAGCTGGCAGACGGTGTACTTCCAGCGCTCGTCAGTCATCGTGACCGAGCTC
TTCTTAGTCTTTGCCCTGCAGAAGTACGTCGACTCGTGCCATGGACCTGCCGCGAAGCGAGCTGCCCAGGCTGCGGCCAT
CTCGATCCTGCTTTCGCCCGGCCTTTTGATCATCGACCACATCCACTTCCAGTACAATGGCTTTCTCTATGGCGTTCTAA
TCTACTCGCTCGTCCTCGCCAAGAAGAAAACCACACTGCTCGGCAGCGGCCTCGTCTTCGCCTCGCTGCTCTGCCTGAAG
CACATATATGCCTACCTGGCGCCTGCATACATCGTCTTTCTGCTGCGCACCTACTGTTTGTCGCCCAAGTCAATCTTTCG
GATTCAGTGGCTCAACTGCGTCAAGCTCGGAAGCGGCATTTCCGCTATTGTCGGCGTCGCATTTGGGCCGTTTGCCCTTC
GCGAACAGATTCCGCAGATTCTCGGCCGGTTGTTTCCGTTTGCGCGCGGTCTTTGCCACGCGTACTGGGCACCCAACGTC
TGGGCCATCTACTCCTTCGCCGACCGGCTCTTAATTCCCCGTACGTCCTCTGTCCCCCGTGGTCTGTCTTCTTTTGCGGC
ACTAACAGTCTAGTCGCTCCACGCTTGGGCTGGGAGTTGAGAGCAGACGCGCTCAACAGCGTGACTCGGGGTCTGGTGGG
CGACACAACCTTTGCGGTGCTGCCAGACGTCAGCCCGCGGATGTGCTTCATCCTCACGGTGCTCTTCCAGGTCATGCCGC
TGCTGAAACTCTTCTTGCAGCCGACCTGGGACAACTTTGTCGGAGCGTTGACGCTGTGCGGGTATGCGTCCTTCCTCTTT
GGCTGGCACGTGCATGAGAAGGCGATTCTTCTGGTCATCATACCATTCAGTCTTCTGGCGCTTAAGGACCGGCGCTATCT
CAGTGCGTTCCGACCGCTGGCCGTAGCGGGACACGTGGCTCTCTTTCCGCTGCTCTTCACGCCAGCTGAGTTTCCGATCA
AGACGGTCTACACCATCTTCTGGCTGGTGGCGTTCCTGCTCATCTTTGACAGCCTGGCGCAGGCCTCGCGGCAGCCGCGC
TTCTTCCTCTTTGACCGGTTCAGCACGCTCTACATTGCGATCAGCATCCCACTGATTCTGTACTGCTCGTTGCTGCACAA
GCTGGTGTTTGGGGGGCAATACGAGTTCCTGCCGCTGATGTTTACAAGCTCCTACTGTGCCATCGGCGTTGTCGGCAGCT
GGGTCGGCTTTGTAGTAGTGTATTTCACCTCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62