GenePrediction:GLEAN_251 Details

Name: GLEAN_251
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:540140..541449 (+ strand)
Length: 1310
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:540140..540160 (+ strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_167:540260..540389 (+ strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_167:540452..541449 (+ strand)
Length: 998
>GLEAN_251 class=GenePrediction position=GCSC_167:540140..541449 (+ strand)
ATGGCTTCTACGGTCGGCAAGGTAAGCTTAGAATTGGTGGGGGCAGCACACAATGGTTCAAGAGACAACAACCAAGGATT
CGACCAGGTGCGGGGCTTTGGACAGCGCTGACTTGTGCAGACTATCACCTGCAAGGCGGCCATCGCCTGGGAGGCTGGCA
AGGAGCTCAGCGTCGAGGACATTGAGGTGCTGCCGCCTCGGGCCCACGAGGTCCGAGTTGAGATCTACTACACTGGTGTC
TGCCACACAGGTATGACTCGGCCCATCAGTTATTTTGTTTTTGTTTGACTGCAGGACGACTGACAGTTGCAGATGCGTAC
ACGCTCTCGGGCAAGGACCCTGAGGGTGCTTTCCCCGTGGTCCTGGGCCACGAGGGCGCCGGTGTTGTCGAGTCGGTGGG
TGAGGGTGTGACCAACGTCAAGCCGGGCGACCATGTGGTGGCCCTGTACACACCCGAGTGCAAGGAGTGCAGGTTCTGCA
AATCGGGCAAGACGAACCTGTGCGGCAAGATCCGGGCAACGCAGGGCAAGGGTCTGCTGCCGGATGCGACGTCGCGGTTC
CGGGCGCGCGGCAAGGATCTGCTGCACTTTATGGGCACGTCGACGTTCTCGCAGTACATTGTGGTGGCGGACATCTCGGT
GGTGGCTATCCAGAAGGACGCGCCGTTTGACCGTGCGTGTCTGCTGGGCTGCGGCATCACGACGGGCTACGGAGCAGCAC
GCGTGACGGCCAACGTGGAAGAGGGCAGCAACGTGGCCATTTTCGGAGCCGGCTGCGTCGGTCTGTCGGTGGTGCAGGGC
GCGGTGGCGAACAAGGCGGGCAAAATCATCGTCGTGGACGTCAACAATTCCAAGGAGGAGTGGTCGCGCAAGTTTGGGGC
GACGGACTTTGTCAACCCGCTGGCGCTGCCCAAGGGCACGACGATCGTCGACAAGCTGATTGAGATGACAGACGGCGGCT
GCGACTACACGTTTGACTGCACGGGCAACGTGCAGGTGATGCGGTCGGCGCTGGAGGCGTGCCACAAGGGCTGGGGCGAG
AGCATCATCATCGGCGTGGCGGCGGCGGGCCAGGAGATCAGCACGCGGCCCTTCCAGCTGGTGACCGGTCGGGTCTGGAG
AGGCTGCGCATTTGGCGGCATCAAGGGCCGGTCGCAGCTGCCAGGTCTTGTGGGCGACTATCTCGAGGGCCGGCTCAAGG
TGGACGAGTTCATCACGCACCGCAAGACGCTGGGCCAGATCAACGAGGCCTTTGAGGTGATGAAGCAAGGCGACTGCATC
CGTGCCGTGGTGGATATGCGCAAGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62