GenePrediction:GLEAN_2520 Details

Name: GLEAN_2520
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1613426..1617165 (+ strand)
Length: 3740
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1613426..1613428 (+ strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_140:1613600..1613662 (+ strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_140:1613733..1613791 (+ strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_140:1613850..1613868 (+ strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_140:1613952..1614014 (+ strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_140:1614108..1615915 (+ strand)
Length: 1808
Type: CDS
Source: GLEAN
Position: GCSC_140:1615999..1616136 (+ strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_140:1616217..1617165 (+ strand)
Length: 949
>GLEAN_2520 class=GenePrediction position=GCSC_140:1613426..1617165 (+ strand)
ATGGTACGTCTGCTATGCAATCTTTCCTTTACTTCATCCCACTCCCCACTCCCTCGTCTCTACCCTACGATCTCGGGCTG
GTGGTCTTGATATATGCTCCTGCCCAATCGCACACACACCTCCGTTTCTTCCACGTTTCTTCTCCGGCTTGCATTCTCAC
GCCCAATTCTGCAGGTGCTGTTCAAGCGCAAACCCGTGCGGTTCGAACCACCTCCAGCGCTCAAAGATGATCAAGAGGTT
GGTTGAAACATGGTCCTGCTATCTGCAGAATGCGCCCATACTGACTTTGGGCCTTGCTCGTATTTAGGTGTGGTATATAG
AGAAGACGGGCGAGGTCTTCACCACATACGAAGACTATCTGGCAAGGTTTGTTTTTCTAGCTCTTCCCTACTTTGCTTAG
ACACGGCACTAACTTGGTGTCTAGAATGGACTTCTACAAACAGGTAAAATAAAAAATAACCCTCTCGATCTTTGCTAATT
TTGGGGGAAGCTGGCAAAGCGACGTCTTGCTAACTGCCCGTAGAAGCGGTTCAACTGCCAAATCACTGGACACTCTAACC
TCTCCTTTTTCGAGGCATTGGAGAGTGAGGTTCGTACCCCCCGCCCCTGTTGTTCTACCCGTCTGGAACTAGCAGATCTG
CTTTGTGGATGTCTGTCCCCTAATGCGTCTCACTTCCAACAGCGAGCCGGTGCCGCCGAGGTCGAGCAAGCCTTTCCCGA
AGCCCTCAAGGGACCCGTCCTTCGCCGCGTCCAGTTCCAGACAGTCTCCCGCATTGATACTCTGGTCGACCAAATCTACG
ACGAGTTCAAGGCAGACTACCATCCTGGTGAGTCTGTCACGGTGACACTCTACGACGGAGAACGGCTACACGGTACTGTT
CGTGATAAGACGAGATATGGCAGCAAGGTTCTCCCAGACGGGACCCTCACTCCGCCTTACACGCGTTACATTGTCAGTCT
CGACGACCGTCCAGGCGAGGAGGCTGTTGTCGAGGAGGCAAACATATTTCGTGACCGCAAAGTGTTCACCAAGTCGGTCC
TACGGTCATTTATCAAGAAGACGGTCGCAAGGGAGGCATGGAATGGCGCACCCTGGTTGGTGAAGAATGACGTGGCTGAG
CAATACCACATCGACACGAGAGTTCCAATTAATCTACAGTACAACAACAAGGTTCTGGAGCGAAAGCAGATGTTGGCTCA
GAGAAAGCTGCAGCAACAGCCCCACGACGTCAGCAGTCTTCTCAATAGCAGCCCCAGCAGTCCCGAATCTCCTATGAACG
GCGGCGGCTTTCGCTTGCCCGAGCTGAAGCCAGCGCCTAAAAGTCACAAGGCCAAGCACATCCAATTGGCCCAGCAACAG
CGGCAACTTCAGCACCAGAAGCAACAGCAGCACCCCAACCCACAAAACGGGGCGGCAAAGGCGCGGCCAAACGGGTTTGC
GCACCACGCAGAGCCCGGCCAGTTCCAGCACCTCCCGCTTCCTAATAATCCGTTTCAATTCTCCTTGTCCATGAGAAACA
CCCCGACGCTTCCGGCACATACCGCCCCAGAGGTGCCCTCGCAGCCGCCTCCACCTCCACCTCCAAAGTACCCCATCGAG
GATCTCCAGCTCGAGCCGAGCGATGCAACGCGCCCAACTCTCAAGTTCCTATGCAATGACCCACCTGTGGATCTAGCCGA
GACGGTCGTACCACCGTTTGCCAAGAAGATCCTGATGAAGTCTGTCGGGCCGCTATTGGAGACCTGGGACTCGTTGAATG
TGTATTGCGAGATCTTTAAGCTGGACTCATTCACTTTCGATGATTTTATAGAGGCAATGCTCTCTGCAAATGACGATACC
CCGGTTCAGCTGTTTGACGAAATCCATTGCGCTGTTCTCAAGACGCTTGTCCAATCCGAGGCAGATGGTGGAGAGGTGCA
AATTCAGCTCCCCGAGCTGGATGACAACGAAGATGATGATGATGACGATAATGATGCCGATGACGACGACGCCGAGCCCG
AGCCCGAGCCAAAACCGGCCACCCGCGCTACAAGGAGTAGCGTAGCCAAATTGGAAGCCGAGCGACTGGCTGCCGAGGCT
GCCGCGGCCGAGAAGGAGAAGGAGAGCGAACCTATCATTGTGCATCGTGCCGAGGACGTCTTGGCCGACTACGACTGGAT
CGATCAGCTCCGGAAGAGAAACTTTCAGGACGGGGGTTGGCAGCTAATGATGGTTGGCCTACTCTATCAGCTGTCGAAAG
ACGAACGTCGCCAGGTCGTCTGCGAGGCTTTGCTGTCGGAAATTGTCCCGCCAAACGTCGAAGCAACCAAAGAAACTGTG
CGGCAACACTACTCGGCCCTCGACATCAACAACCGTGTGCAGGCACTCCAGATCATCTGCATGCTAACCGTTGATACGAA
GGCCTTCCGTGGTTATATGGAAGACTGCAGTGAACAGATGACCAAGTATCGGAAGGAGAAGATTGAATGGCAGCGGGCGA
GAAAACAAGCGTATGTAGACTTCTCCCTTGTCTGTCTTTTCATCTGTTCTTCTACTTGTTTTTCGGGGCGAAACACTCAC
TGACATTTGCCAGAATCGAGGATTTGAAACCGCTAAACGACCAGCGTAAAATTCTCCTGCCGGATAACCTCCCACCTTCT
CCTCCTCTGGATTATCCTCTGGAGCCGGCCAAGTTGGACGCGGATGTGAAAATGAGCGATGCCGAGGACTTGTCATCTCA
CGCTCTAGACGAAGATGGCATGGATACCGAGGACGAAAGAACGCAACGGTTCGGGGACGCAACCTGCGCAGAGCCGAGGA
CCGTGCCGCTCAGCGGAAGCGCAAGAGAGAAGAGCAATATGAGCGCAAGCGGGAAGCCGAAGCAGCTGCAAAGGTGCCCA
AGCAGTCCAAGCAGTTTATCAAAGTTAAGCGGGACATCGAGAAAAAAGAGGCTGAAATCAAAAGTTGCGAGGAAGAGATT
GCCATCCTCGACAACGACCTGCGCGAGGCCGATTGCCCACGCACGCGTGTTCTTGGCAAGGACCGCTTCTGGAACCGGTA
TTATTGGTTCGAACGCAACGGCATGCCCTACGGCGGGCTGCCCACAAGCTCGACCGCCACGGCTAATTATGCCAACGGCT
GCCTCTGGGTGCAAGGCCCTGACCAACTGGAACGCGAGGGCTATATCGACATGGCGCCCGAATACCAGAATGAGTACAAG
GCCAAGTTCGACATGACCGTTCCAGAGCGCAAGAAGCGGGAAGAGGGGGCGACGAGTCTGTTCGACGCAGGCCAGTGGGG
TTTCTTCTCGGAGCCTGAAGATCTGGACGCGCTGATCGACTGGCTGGACCCGCGAGGCTTCAATGAAATGAGGCTGCGCA
AAGAACTGGTCATATTCCGCAGCAAGATCATTGCGAACATGGGGAACCGTCATCAATATGTGTCTCAGCCAGACAGTGAA
GTCAGTGAGGATAAGGACAAAAACAAGGCTACACCAGTACCAATCACATCATCAGGGAAGCGCATGAGCACTCGCACTCG
AGCGGCGCTAACACCGGAGCTAACACCGCCTACTTTGCGCTGCACCAGTTGGGTCAACAGCATGGCCATCGACGACCTCG
GCCATGTCCATAGCGAACAGCCTCCTCCAGTCCGGCCACGGAAGCAGAGCCGGAAGAAGGAGGCTGCTGCTGCCAGCGAG
GCATCGGAACCACCGCGGAAGAAGGCCATGACGCGACAAGGAACTCGATACCACTCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62