GenePrediction:GLEAN_2521 Details

Name: GLEAN_2521
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1620811..1621567 (+ strand)
Length: 757
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1620811..1621246 (+ strand)
Length: 436
Type: CDS
Source: GLEAN
Position: GCSC_140:1621320..1621567 (+ strand)
Length: 248
>GLEAN_2521 class=GenePrediction position=GCSC_140:1620811..1621567 (+ strand)
ATGCCTCACGACCGGGCGACGCAACAGTCTCTTGGCTTGTTCCACGGGTACCCTGCCTGGTACAGAAAATACCAGATTGA
CAACTATGGACTCGGTAGCAGGACGCAGCTGTCATCTTCTGCACAAGTTCAGTTCCGGGCGCCTCATCAAGCTTCTCTGC
AAAGTGACAGCTCAGTGAACGCTACCAGCAACGGCACGGCCGGCATTCCCCTCGGACAAGACGCCAGGGGTGTGGCAGTT
GGAAGTGCGCTCGAGACGGACGGATGGAGGCCGAGACCTGTCACCCTGTCTTGGCAGCCGCAACAGGCTGTCCAGAGGGA
AGGCGGCGGTGAGAATAGGAACAGCATTCTAGAGCGGATGATGTCGGCGATGGGACTCGCTAGCGCTGGGCAGCCAGGCG
ACCAGTCTGTGGAAGTGATAGGCAGCCAGCCAGTGGGTATGTGCCAACGATCACTTTGTGTCAACTCATTGCTGGGGCTC
TGTTGCTGACAAGCGTTGTTGCGTATTAGTTCCCTTTACCGCCGGCCAGCAATACCGGCCACGTTTGGATTATCCCAGTC
ATGAAAGCAGTCTCCCTTCTGAAAATATAACCCGCGACTTTGGGCCAATCGCCCCTCCCTCGGCGCCTTCAGCGTTTACT
TTTTCTGAAAATGCAACGACTAAAGATGCATTTCCTGCCACCCCTCCTCGCGGGTTTACCACATATCAGAGTAGTTTAGT
CACTATCCGAGATGACGACGGAGGAGCCCACGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62