GenePrediction:GLEAN_2523 Details

Name: GLEAN_2523
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1635555..1636653 (+ strand)
Length: 1099
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1635555..1635579 (+ strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_140:1635647..1636653 (+ strand)
Length: 1007
>GLEAN_2523 class=GenePrediction position=GCSC_140:1635555..1636653 (+ strand)
ATGGCATCATTAATGCGAGCCGTGGGTGAGTGGAGGAAACGGCAGAACGAGACGCAAGACCGTCTGACGACAGCATGACC
TGACCATTACAGACATCCGGGATGGCAAGGGTGATGCGGACGCCCTGTTCATCAACGACAAGACGGCCAAGCCGACGGCC
GGAGCGGGCGAGGCGGTGGTGCGCATAAAGGCCTTTGGACTGAACCGCATGGACCTGCTGCAGCGCCAAGGCCTCTATCC
GTTGCCGCCACAGGCGCCGGCGACGATGGGAGTCGAATTCAGCGGTGTAGTCGAGTCGCTGGGTGAGGCCGATTCGGCAG
ACACGGCCAGCTTTGCCGTGGGCGACGAAGTGTTTGGGCTGGCGTACGGCGGCGCCTATGCCGAGTATGTGCGGGTGTCG
ACGCGGATGCTGCTACACAAGCCGACTTCGCTGGGCTGGAACGAGGCCGCGGGTCTGCCGGAGACCTGGCTGACGGCCCT
GCAGGCGCTGCACGAGGTGGGCGGCTTCCGCAGCGGCAATGATGGCCAGACGACGTTGTGGCATGCCGGCGCGTCGGGCG
TCAGCATCGCCGGCATTCAGCTGTCCCGGCGAGCCGGCGCCAAGGCTGTCTATGCCACGGCCGGCTCCGATGCCAAATGT
GCCTTTGTCGTCGACCAGCTCGGCGCCACGGCCGCCTTCAACTACAAGACCGAGGACTGGGTGCAGAAGATGGTCGACGC
CACAGATGGCACCGGTGTCGACCTGATTGTCGACTATGTCGGCGCAGACTACTTCCAGAAAAACCTCACTGTTGCTGCAC
GTGACGCCCACATCGTCCTGCTCGCCTTTCTCAGCGGCGCCGTGCTGCCGGCCGGCGTCAACATCAGTCCTCTACTGATC
AAGCGCGTGCGCATCGAGGGCTCGTCGCTGCGCAGCCGCGACCTCGACTACCAGTCCCGCCTACGCGATCGGCTCGCCGA
CGTGCTCCCCGGCTTCCACAGCGGCGACCTCCGCATTTTTGTCGACCGCGTGCTGCCCTGGACCGAGATCGTGGAGGCAC
ACAAGTACATGGAGGCCAACATGTCGATGGGCAAGATCATCTGCACGATTCCATGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62